Primers and probe for detecting peste des petits ruminants virus and kit
A PPR and kit technology, applied in the field of molecular biology, can solve the problems of high false positives and low detection sensitivity, and achieve the effects of improving the positive rate, simplifying the procedure and shortening the detection cycle.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Example 1 Design and synthesis of primers and probes used in the real-time fluorescent quantitative PCR detection method of Peste des ruminants virus
[0040] According to the gene sequence of Peste des ruminants virus published by GenBank, the highly conserved N gene was selected as the amplification region through sequence alignment, and a pair of specific primers and a probe were designed. The primers and probes were synthesized by Bao Bioengineering (Dalian) Co., Ltd. , PCR amplification product is 60bp.
[0041] The above primer sequence is:
[0042] Upstream primer F: 5'-TCCATCATTACCCGTTCAAGACT-3' (SEQ ID NO. 2),
[0043] Downstream primer R: 5'-GTCAGGATCTCCGGCCAAT-3' (SEQ ID NO. 3).
[0044] The probe sequence is:
[0045] (FAM) 5'-CTCGACAGGCTTGTCA-3' (TAMRA) (SEQ ID NO. 4).
[0046] The sequence of the amplified target gene is:
[0047] TCCATCATTACCCGTTCAAGACTGCTCGACAGGCTTGTCAGATTGGCCGGAGATCCTGAC (SEQ ID NO. 1).
[0048] The nucleotide sequence shown in SEQ ID NO. 1 can be u...
Embodiment 2
[0050] Example 2 Establishment of real-time fluorescent quantitative PCR detection method for Peste des ruminants virus
[0051] 1. Experimental materials
[0052] 1.1 Virus species, strains and vectors
[0053] Peste des petits ruminant virus (PPRV) N75 / 1 strain (purchased from China Veterinary Drug Administration), measles virus (MV), canine distemper virus (CDV) are kept in our laboratory; DH5α competent cells are kept in our laboratory; 2.1-T cloning kit was purchased from Invitrogen.
[0054] 1.2 Main instruments and reagents
[0055] iQ5 fluorescent quantitative PCR instrument was purchased from Bio-Rad; DNA fragment recovery kit and fluorescent quantitative PCR 2×Ex premix Taq kit were purchased from Bao Bioengineering (Dalian) Co., Ltd.; plasmid small extraction kit was purchased From Tiangen Biochemical Technology (Beijing) Co., Ltd.; reverse transcriptase (AMV, 200U / μL) was purchased from Promega.
[0056] 1.3 Primer and probe
[0057] Refer to Example 1 for the nucleotide seq...
Embodiment 3
[0083] Example 3 Evaluation of the sensitivity, specificity and detection limit of the PPRV fluorescent PCR detection system
[0084] 1. Sensitivity evaluation
[0085] Sensitivity, also known as true positive rate, is actually the percentage that is correctly judged as Peste des petits ruminants according to the standard of the detection method of the present invention. The fluorescent quantitative PCR detection system of Peste des petits ruminant virus established by the invention and the ordinary reverse transcription PCR method are used to simultaneously detect 105 pieces of clinically isolated disease materials suspected of Peste des petits ruminants. As shown in Table 1, the method established by the present invention has a sensitivity of 98.9% (92 / 93) compared with ordinary RT-PCR (that is, the probe of the present invention is not added, and the primers used are the same as the method of the present invention).
[0086] Table 1 Evaluation of the detection results of fluoresc...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 