Unlock instant, AI-driven research and patent intelligence for your innovation.

Primers and probe for detecting peste des petits ruminants virus and kit

A PPR and kit technology, applied in the field of molecular biology, can solve the problems of high false positives and low detection sensitivity, and achieve the effects of improving the positive rate, simplifying the procedure and shortening the detection cycle.

Inactive Publication Date: 2013-11-27
INST OF ANIMAL SCI OF CHINESE ACAD OF AGRI SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These methods can be used for the detection of small ruminant virus, but there are shortcomings such as low detection sensitivity and high false positive

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primers and probe for detecting peste des petits ruminants virus and kit
  • Primers and probe for detecting peste des petits ruminants virus and kit
  • Primers and probe for detecting peste des petits ruminants virus and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1 Design and synthesis of primers and probes used in the real-time fluorescent quantitative PCR detection method of Peste des ruminants virus

[0040] According to the gene sequence of Peste des ruminants virus published by GenBank, the highly conserved N gene was selected as the amplification region through sequence alignment, and a pair of specific primers and a probe were designed. The primers and probes were synthesized by Bao Bioengineering (Dalian) Co., Ltd. , PCR amplification product is 60bp.

[0041] The above primer sequence is:

[0042] Upstream primer F: 5'-TCCATCATTACCCGTTCAAGACT-3' (SEQ ID NO. 2),

[0043] Downstream primer R: 5'-GTCAGGATCTCCGGCCAAT-3' (SEQ ID NO. 3).

[0044] The probe sequence is:

[0045] (FAM) 5'-CTCGACAGGCTTGTCA-3' (TAMRA) (SEQ ID NO. 4).

[0046] The sequence of the amplified target gene is:

[0047] TCCATCATTACCCGTTCAAGACTGCTCGACAGGCTTGTCAGATTGGCCGGAGATCCTGAC (SEQ ID NO. 1).

[0048] The nucleotide sequence shown in SEQ ID NO. 1 can be u...

Embodiment 2

[0050] Example 2 Establishment of real-time fluorescent quantitative PCR detection method for Peste des ruminants virus

[0051] 1. Experimental materials

[0052] 1.1 Virus species, strains and vectors

[0053] Peste des petits ruminant virus (PPRV) N75 / 1 strain (purchased from China Veterinary Drug Administration), measles virus (MV), canine distemper virus (CDV) are kept in our laboratory; DH5α competent cells are kept in our laboratory; 2.1-T cloning kit was purchased from Invitrogen.

[0054] 1.2 Main instruments and reagents

[0055] iQ5 fluorescent quantitative PCR instrument was purchased from Bio-Rad; DNA fragment recovery kit and fluorescent quantitative PCR 2×Ex premix Taq kit were purchased from Bao Bioengineering (Dalian) Co., Ltd.; plasmid small extraction kit was purchased From Tiangen Biochemical Technology (Beijing) Co., Ltd.; reverse transcriptase (AMV, 200U / μL) was purchased from Promega.

[0056] 1.3 Primer and probe

[0057] Refer to Example 1 for the nucleotide seq...

Embodiment 3

[0083] Example 3 Evaluation of the sensitivity, specificity and detection limit of the PPRV fluorescent PCR detection system

[0084] 1. Sensitivity evaluation

[0085] Sensitivity, also known as true positive rate, is actually the percentage that is correctly judged as Peste des petits ruminants according to the standard of the detection method of the present invention. The fluorescent quantitative PCR detection system of Peste des petits ruminant virus established by the invention and the ordinary reverse transcription PCR method are used to simultaneously detect 105 pieces of clinically isolated disease materials suspected of Peste des petits ruminants. As shown in Table 1, the method established by the present invention has a sensitivity of 98.9% (92 / 93) compared with ordinary RT-PCR (that is, the probe of the present invention is not added, and the primers used are the same as the method of the present invention).

[0086] Table 1 Evaluation of the detection results of fluoresc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a genetic marker, real-time fluorescence quantitative PCR (polymerase chain reaction) primers and a probe used for detecting peste des petits ruminants through the N gene sequencing and comparison of the peste des petits ruminants, and the nucleotide sequences of the genetic marker, the primers and the probe are respectively disclosed in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4. The invention also provides a quantitive detection method and a detection kit for the peste des petits ruminants virus. The detection method and the detection kit disclosed by the invention have the advantages of accuracy in detection, high flexibility, strong specificity, easiness and rapidness, and the specimen detection capacity is good.

Description

Technical field [0001] The present invention relates to the field of molecular biology, in particular to target sequences, fluorescent quantitative PCR primers and probes for detecting Peste des petits ruminants. The invention also relates to methods and kits for detecting Peste des petits ruminants using the target sequences. Background technique [0002] Peste des petits ruminants (PPR) is an acute, potent and contact infectious disease caused by the Peste des petits ruminants virus (PPRV). Due to its high morbidity and mortality, It poses a great threat to animals such as goats, sheep, white-tailed deer, wild gazelles and Tibetan antelopes, and is recognized as a severe infectious disease worldwide. my country also classifies the disease as a type of animal infectious disease. In 1942, West Africa’s Cote d’Ivoire first reported the Peste des Petits Ruminants, and most countries in Africa have reported the occurrence of the disease. In recent years, Peste des petits ruminants h...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11G01N21/64
Inventor 史利军金红岩王勇程超飞黄华欣李刚朱鸿飞
Owner INST OF ANIMAL SCI OF CHINESE ACAD OF AGRI SCI