Genetic marker of canine parvovirus and specific primers as well as probe thereof

A technology of canine parvovirus and genetic markers, applied in the field of biological detection, can solve the problems of inadaptability to early detection, rapid detection, and difficulty in obtaining fresh red blood cells, and achieve the effects of shortening the detection cycle, good specificity, and increasing the positive rate

Inactive Publication Date: 2016-04-06
INST OF ANIMAL SCI CAAS
View PDF2 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among them, the HA test is the most economical, but its disadvantages are that on the one hand, it is difficult to obtain fresh red blood cells; on the other hand, this method is only suitable for the detection of samples in the late stage of CPV infection, and does not meet the requirements of early and rapid detection in recent years.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genetic marker of canine parvovirus and specific primers as well as probe thereof
  • Genetic marker of canine parvovirus and specific primers as well as probe thereof
  • Genetic marker of canine parvovirus and specific primers as well as probe thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Example 1 Design and synthesis of primers and probes used in canine parvovirus real-time fluorescent quantitative PCR detection method

[0044] According to the canine parvovirus gene sequence published by GenBank, the highly conserved VP2 gene was selected as the amplified region by sequence comparison, and a pair of specific primers and a probe were designed. The primers and probe were synthesized by Bao Biological Engineering (Dalian) Co., Ltd. , PCR amplification product is 137bp.

[0045] The above primer sequences are:

[0046] Upstream primer F: 5'-GCACCATATTATTCTTTTGAG-3' (SEQ ID NO.2),

[0047] Downstream primer R: 5'-CCATGTTGTCTACCAAATG-3' (SEQ ID NO.3).

[0048] The probe sequence is:

[0049] 5'-FAM-ATATCTTGGATCACCATCTGCTGCT-TAMRA-3'

[0050] (SEQ ID NO. 4).

[0051] The amplified target gene sequence is:

[0052] GCACCATATTATTCTTTTGAGGCGTCTACACAAGGGCCATTTAAAACACCTATTGCAGCAGGACGGGGGGGAGCGCAAACAGATGAAAATCAAGCAGCAGATGGTGATCCAAGATATGCATTTGGTAGACAACATGG (S...

Embodiment 2

[0054] Example 2 Establishment of canine parvovirus real-time fluorescent quantitative PCR detection method

[0055] 1. Experimental materials

[0056] 1.1 Virus species, strains and vectors

[0057] Canine parvovirus (CPV2), porcine parvovirus (PPV) and gosling plague virus (GPV) are preserved by our laboratory; DH5α competent cells are preserved by our laboratory; pCR 2.1-T cloning kit was purchased from Invitrogen.

[0058] 1.2 Main instruments and reagents

[0059] The iQ5 fluorescent quantitative PCR instrument was purchased from Bio-Rad; the DNA fragment recovery kit and the fluorescent quantitative PCR2×ExpremixTaq kit were purchased from Bao Biological Engineering (Dalian) Co., Ltd.; the plasmid mini-extraction kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.

[0060] 1.3 Primers and probes

[0061] See Example 1 for the sequences of the upstream primer F, the downstream primer R and the probe.

[0062] 2. Methods and results

[0063] 2...

Embodiment 3

[0083] Sensitivity, specificity and detection limit evaluation of embodiment 3CPV fluorescent PCR detection system

[0084] 1. Sensitivity evaluation

[0085] Sensitivity, also known as true positive rate, is actually the percentage that is correctly judged as canine parvovirus according to the standard of the detection method of the present invention. The fluorescent quantitative PCR detection system for canine parvovirus established by the present invention and the common PCR method were used to simultaneously detect 120 suspected canine parvovirus clinically isolated disease materials. As shown in Table 1, the sensitivity of the method established by the present invention can reach 98.1% (101 / 103) compared with ordinary PCR (that is, the probe of the present invention is not added, and the primers used are the same as the method of the present invention).

[0086] Table 1 Evaluation of fluorescent quantitative PCR and ordinary PCR detection results

[0087]

[0088] 2....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a genetic marker for detecting canine parvovirus, and the genetic marker contains a nucleotide sequence as shown in SEQ ID NO.1. The invention also provides specific primers and a probe for detecting the genetic marker, a method for quantitative detection on the canine parvovirus and a detection kit. The method and the kit, provided by the invention, have the advantages of high sensitivity, strong specificity and easiness in operation, can meet the requirement of rapid detection on sick animals or products thereof, and has the significance for guaranteeing healthy development of the domestic animal husbandry and preventing the canine parvovirus from spreading, and meanwhile provides a new technological means for study on pathogenicity of the canine parvovirus in a natural reservoir.

Description

technical field [0001] The invention relates to the field of biological detection, in particular to a genetic marker of canine parvovirus and its specific primers and probes, and also relates to a method and kit for detecting canine parvovirus by using the target sequence. Background technique [0002] Canine parvovirus (Canine Parvovirus, CPV) can cause canine parvovirus disease, which is a highly contagious and severe infectious disease of dogs. The clinical symptoms are mainly characterized by hemorrhagic enteritis or non-suppurative myocarditis. One of the worst diseases. CPV belongs to the family Parvoviridae, the genus Parvovirus, a linear negative-sense single-stranded DNA virus with a genome length of 5323bp, encoding structural proteins VP1, VP2 and VP3 and non-structural proteins NS1 and NS2. [0003] VP2 is the main capsid protein of CPV, which encodes the main antigenic determinant of CPV, can induce the body to produce neutralizing antibodies, and is also consi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11C12N15/35
CPCC12Q1/70C12Q1/686
Inventor史利军崔尚金王净周灵袁维峰
OwnerINST OF ANIMAL SCI CAAS