Unlock instant, AI-driven research and patent intelligence for your innovation.

Vaccine for treatment of tautopathy

A vaccine and protein technology, applied in the field of vaccines for the treatment of tau protein diseases, can solve the problems of social lack of memory and no confirmed improvement effect, and achieve the effect of improving memory loss and inhibiting the progress of symptoms

Active Publication Date: 2012-10-03
KYOTO UNIV
View PDF22 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] As a therapeutic agent related to the present invention, although adeno-associated virus carrying a gene encoding β-amyloid protein is reported as a therapeutic agent for Alzheimer's disease (Patent Documents 1, 2, Non-Patent Document 8), Tau method of inoculating Alzheimer's disease and tauopathies (patent document 3, non-patent document 9), etc., but it was confirmed that coordination movement / motor learning was improved in tauopathies model mice inoculated with tau protein However, in dementia patients with lack of sociality and memory loss, the effect of improving the symptoms that are considered to be characteristic has not been confirmed.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Vaccine for treatment of tautopathy
  • Vaccine for treatment of tautopathy
  • Vaccine for treatment of tautopathy

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0127] Construction of F gene-deleted Sendai virus vector carrying mutant Tau gene

[0128] 1) Construction of secretory signal sequence and Sendai virus vector expressing Tau protein

[0129] The secretory signal sequence is based on amyloid precursor protein (APP, sequence database accession number: NT_011512.11, NW_001838706.1, NM_201414.1, NM_201413.1, NM_000484.2, NM_001136130.1, NM_001136129.1), using the following sequence.

[0130] 5'-ggtctagaatgctgcccggtttggcactgctcctgctggccgcctggacggctc gggcgctt-3 (serial number 2)

[0131] The cDNA of the mutant Tau protein (TauP301S) added a mutated sequence to the base sequence of the human 1N4R type Tau protein (sequence database accession number: NM_001123067.2) [from the 272th position ( The mutation corresponding to the proline (P) codon at position 301 of SEQ ID NO: 1) to the serine (S) codon; the serine codon (tcg) at positions 884-886 of SEQ ID NO: 13] as a template, using The following primers were used for amplificatio...

Embodiment 2

[0143] Construction of plasmid vector carrying mutant Tau gene

[0144] 1) Construction of secretion signal sequence and plasmid vector expressing Tau protein

[0145] The base sequence of the CD59 protein (Sequence Database accession numbers: NM_001127227.1, NM_001127226.1, NM_000611.5, NM_203331.2, NM_001127225.1, NM_203329.2, NM_203330.2, NM_001127223.1) was used as the secretion signal sequence the following sequence.

[0146] 5'-atgggaatccaaggagggtctgtcctgttcgggctgctgctcgtcctggctgtcttctgccattcaggtcatagc-3' (serial number 3)

[0147] The cDNA of the mutant Tau protein (TauP301S) added a mutated sequence to the sequence of the human 1N4R type Tau protein (sequence database accession number: NM_001123067.2) [from the 272th position of the amino acid sequence recorded in NM_001123067.2 (corresponding to The mutation of the proline (P) codon at position 301 of SEQ ID NO: 1) to the serine (S) codon; the serine codon (agt) at positions 898-900 of SEQ ID NO: 12] as a template, us...

Embodiment 3

[0157] In vivo test using an F gene-deleted Sendai virus vector carrying a mutant Tau gene

[0158] 1) Nasal administration of F gene-deleted Sendai virus vector expressing GFP to mice

[0159] The present invention was carried out using 3-month-old tauopathic model mice (P301S Tau transgenic mice) (provided by Yoshiyama, Y, et al. Neuron 53, 337-351 (2007); University of Pennsylvania Dr. Trojanowski) The F gene-deleted Sendai virus vector carrying GFP (hereinafter referred to as "Sev-GFP") was administered nasally, and the infection efficiency was examined.

[0160] Sev-GFP 5x10 per 1 mouse 6 CIU, using a multifunctional microscope (BZ-9000, Keyence) to perform fluorescence imaging and bright field image shooting, and analyze the expression of GFP in the nasal mucosa after 1 week.

[0161] As a result of the analysis, the expression of GFP was seen in a wide range of nasal mucosa, confirming that the transnasal administration of the Sendai virus vector is effective ( figur...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Disclosed is a vaccine for preventing or treating tautopathy, comprising a vector carrying a nucleic acid encoding a mutant tau protein linked to a secretion signal sequence as an active ingredient. The vaccine can induce an antibody against an (optionally phospholylated) tau protein in a subject in a further sustained manner compared with a case where the mutant tau protein is administered directly.

Description

technical field [0001] The present invention relates to a carrier expressing mutant Tau protein which can be used for the prevention or treatment of tauopathy and the use of the carrier as medicine. Background technique [0002] Tau (tau) protein is a soluble phosphorylated protein that exists in the state of binding to microtubules in the normal brain, contributes to the aggregation and stabilization of microtubules, and repeatedly binds and dissociates with microtubules Stay in balance when leaving. When this equilibrium state collapses due to abnormalities in phosphorylation / dephosphorylase, etc., free Tau protein in the cytoplasm increases, leading to aggregation or fibrosis. In most of the dementias of the elderly, mainly Alzheimer's disease or frontotemporal dementia, the accumulation of tau protein aggregates, which is not necessarily accompanied by amyloid accumulation, is considered to be characteristic Neurodegenerative diseases with pathological changes are coll...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K39/00A61K35/76A61K48/00A61P25/14A61P25/22A61P25/28
CPCA61K39/0005A61K39/0007C07K14/4711A61K2039/53A61P25/14A61P25/22A61P25/28C07K2319/02C12N2799/021A61K2039/5256
Inventor 井上治久竹内启喜高桥良辅樋口真人季斌须原哲也
Owner KYOTO UNIV