Vaccine for treatment of tautopathy
A vaccine and protein technology, applied in the field of vaccines for the treatment of tauopathies, can solve problems such as no confirmed improvement effect, lack of social memory, etc., and achieve the effect of improving memory loss and inhibiting the progress of symptoms
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0127] Construction of F gene-deleted Sendai virus vector carrying mutant Tau gene
[0128] 1) Construction of secretory signal sequence and Sendai virus vector expressing Tau protein
[0129] The secretory signal sequence is based on the amyloid precursor protein (APP, SEQ ID NO: NT_011512.11, NW_001838706.1, NM_201414.1, NM_201413.1, NM_000484.2, NM_001136130.1, NM_001136129.1), using the following sequence.
[0130] 5'-ggtctagaatgctgcccggtttggcactgctcctgctggccgcctggacggctc gggcgctt-3 (serial number 2)
[0131] The cDNA of the mutant Tau protein (TauP301S) was obtained by adding a mutated sequence to the nucleotide sequence of the human 1N4R type Tau protein (Sequence database accession number: NM_001123067.2) [from the 272nd position of the amino acid sequence described in NM_001123067.2 ( Mutation of proline (P) codon to serine (S) codon corresponding to position 301 of SEQ ID NO: 1; serine codon (tcg) at positions 884 to 886 of SEQ ID NO: 13] as a template, using The f...
Embodiment 2
[0143] Construction of plasmid vector carrying mutant Tau gene
[0144] 1) Construction of secretion signal sequence and plasmid vector expressing Tau protein
[0145] As the secretion signal sequence, the base sequence of CD59 protein (SEQ ID NO: NM_001127227.1, NM_001127226.1, NM_000611.5, NM_203331.2, NM_001127225.1, NM_203329.2, NM_203330.2, NM_001127223.1) was used the following sequence.
[0146] 5’-atgggaatccaaggagggtctgtcctgttcgggctgctgctcgtcctggctgtcttctgccattcaggtcatagc-3’ (serial number 3)
[0147] The cDNA of the mutant Tau protein (TauP301S) added a mutated sequence [from the 272nd position of the amino acid sequence (corresponding to the Mutation of proline (P) codon at position 301 of SEQ ID NO: 1 to serine (S) codon; serine codon (agt) at positions 898 to 900 of SEQ ID NO: 12] as a template, the following Primers were amplified by PCR. In addition, in order to distinguish the mutant Tau carried in the present plasmid vector and the mutant Tau carried in the S...
Embodiment 3
[0157] In vivo test using F gene-deleted Sendai virus vector carrying mutant Tau gene
[0158] 1) Nasal administration of GFP-expressing F gene-deleted Sendai virus vector to mice
[0159] The present invention was carried out using 3-month-old tauopathy model mice (P301S Tau transgenic mice) (provided by Yoshiyama, Y, et al. Neuron 53, 337-351 (2007); University of Pennsylvania Dr. Trojanowski) The GFP-carrying F gene-deleted Sendai virus vector (hereinafter referred to as "Sev-GFP") was administered nasally, and the infection efficiency was examined.
[0160] Administer Sev-GFP 5x10 per mouse 6 CIU, fluorescence imaging and bright-field imaging were performed with a multi-function microscope (BZ-9000, Keyence), and the expression of GFP in the nasal mucosa was analyzed after 1 week.
[0161] As a result of the analysis, the expression of GFP was seen in a wide range of the nasal mucosa, confirming that the nasal administration of the Sendai virus vector is effective ( fig...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


