Unlock instant, AI-driven research and patent intelligence for your innovation.

Vaccine for treatment of tautopathy

A vaccine and protein technology, applied in the field of vaccines for the treatment of tauopathies, can solve problems such as no confirmed improvement effect, lack of social memory, etc., and achieve the effect of improving memory loss and inhibiting the progress of symptoms

Active Publication Date: 2014-07-16
KYOTO UNIV
View PDF23 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] As a therapeutic agent related to the present invention, although adeno-associated virus carrying a gene encoding β-amyloid protein is reported as a therapeutic agent for Alzheimer's disease (Patent Documents 1, 2, Non-Patent Document 8), Tau method of inoculating Alzheimer's disease and tauopathies (patent document 3, non-patent document 9), etc., but it was confirmed that coordination movement / motor learning was improved in tauopathies model mice inoculated with tau protein However, in dementia patients with lack of sociality and memory loss, the effect of improving the symptoms that are considered to be characteristic has not been confirmed.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Vaccine for treatment of tautopathy
  • Vaccine for treatment of tautopathy
  • Vaccine for treatment of tautopathy

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0127] Construction of F gene-deleted Sendai virus vector carrying mutant Tau gene

[0128] 1) Construction of secretory signal sequence and Sendai virus vector expressing Tau protein

[0129] The secretory signal sequence is based on the amyloid precursor protein (APP, SEQ ID NO: NT_011512.11, NW_001838706.1, NM_201414.1, NM_201413.1, NM_000484.2, NM_001136130.1, NM_001136129.1), using the following sequence.

[0130] 5'-ggtctagaatgctgcccggtttggcactgctcctgctggccgcctggacggctc gggcgctt-3 (serial number 2)

[0131] The cDNA of the mutant Tau protein (TauP301S) was obtained by adding a mutated sequence to the nucleotide sequence of the human 1N4R type Tau protein (Sequence database accession number: NM_001123067.2) [from the 272nd position of the amino acid sequence described in NM_001123067.2 ( Mutation of proline (P) codon to serine (S) codon corresponding to position 301 of SEQ ID NO: 1; serine codon (tcg) at positions 884 to 886 of SEQ ID NO: 13] as a template, using The f...

Embodiment 2

[0143] Construction of plasmid vector carrying mutant Tau gene

[0144] 1) Construction of secretion signal sequence and plasmid vector expressing Tau protein

[0145] As the secretion signal sequence, the base sequence of CD59 protein (SEQ ID NO: NM_001127227.1, NM_001127226.1, NM_000611.5, NM_203331.2, NM_001127225.1, NM_203329.2, NM_203330.2, NM_001127223.1) was used the following sequence.

[0146] 5’-atgggaatccaaggagggtctgtcctgttcgggctgctgctcgtcctggctgtcttctgccattcaggtcatagc-3’ (serial number 3)

[0147] The cDNA of the mutant Tau protein (TauP301S) added a mutated sequence [from the 272nd position of the amino acid sequence (corresponding to the Mutation of proline (P) codon at position 301 of SEQ ID NO: 1 to serine (S) codon; serine codon (agt) at positions 898 to 900 of SEQ ID NO: 12] as a template, the following Primers were amplified by PCR. In addition, in order to distinguish the mutant Tau carried in the present plasmid vector and the mutant Tau carried in the S...

Embodiment 3

[0157] In vivo test using F gene-deleted Sendai virus vector carrying mutant Tau gene

[0158] 1) Nasal administration of GFP-expressing F gene-deleted Sendai virus vector to mice

[0159] The present invention was carried out using 3-month-old tauopathy model mice (P301S Tau transgenic mice) (provided by Yoshiyama, Y, et al. Neuron 53, 337-351 (2007); University of Pennsylvania Dr. Trojanowski) The GFP-carrying F gene-deleted Sendai virus vector (hereinafter referred to as "Sev-GFP") was administered nasally, and the infection efficiency was examined.

[0160] Administer Sev-GFP 5x10 per mouse 6 CIU, fluorescence imaging and bright-field imaging were performed with a multi-function microscope (BZ-9000, Keyence), and the expression of GFP in the nasal mucosa was analyzed after 1 week.

[0161] As a result of the analysis, the expression of GFP was seen in a wide range of the nasal mucosa, confirming that the nasal administration of the Sendai virus vector is effective ( fig...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

This invention relates to a vaccine for preventing or treating tautopathy, comprising a vector, as an active ingredient, comprising a nucleic acid encoding a mutant tau protein linked to a secretion signal sequence, wherein the vaccine is capable of inducing an antibody against an (optionally phospholylated) tau protein in a subject in a more sustained manner compared with a case where the mutant tau protein is administered directly.

Description

technical field [0001] The present invention relates to a vector for expressing a mutant Tau protein that can be used for the prevention or treatment of tauoopathy and the use of the vector as a pharmaceutical. Background technique [0002] Tau (tau) protein is a soluble phosphorylated protein that exists in the state of being bound to intracellular microtubules in the normal brain, contributes to the promotion and stabilization of microtubule polymerization, and repeatedly binds and dissolves with microtubules Balance when leaving. When this equilibrium state is disrupted by abnormal phosphorylation / dephosphorylation enzymes, etc., free tau protein in the cytoplasm increases, resulting in aggregation or fibrosis. Accumulation of tau protein aggregates, which is not necessarily accompanied by accumulation of amyloid, is considered to be characteristic of most of the dementias of the elderly, mainly Alzheimer's disease or frontotemporal dementia. The pathological neurodegen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A61K39/00A61K35/76A61K48/00A61P25/14A61P25/22A61P25/28
CPCC07K14/4711C12N2799/021A61K2039/53C07K2319/02A61K39/0005A61K39/0007A61P25/14A61P25/22A61P25/28A61K2039/5256
Inventor 井上治久竹内启喜高桥良辅樋口真人季斌须原哲也
Owner KYOTO UNIV