Supercharge Your Innovation With Domain-Expert AI Agents!

Vibrio parahaemolyticus detection primer set and detection method

A technology of Vibrio hemolyticus and detection method, which is applied in the field of primer sets for detection based on Vibrio parahaemolyticus, can solve the problems of time-consuming, not being used, laborious and the like, and achieves the effect of good repeatability and high specificity

Inactive Publication Date: 2012-10-24
冯家望 +2
View PDF1 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The traditional detection method of Vibrio parahaemolyticus is a simple microbial multiplication step, which is specific for pathogens that use food as a carrier. Although reliable, it is laborious and time-consuming, requiring 4 to 7 days to complete
Therefore, when it is necessary to evaluate the safety of microorganisms in food in a timely and rapid manner, it is usually not used

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Vibrio parahaemolyticus detection primer set and detection method
  • Vibrio parahaemolyticus detection primer set and detection method
  • Vibrio parahaemolyticus detection primer set and detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] A primer set for detection of Vibrio parahaemolyticus provided in Example 1 includes the following primers:

[0040] A primer set for detection of Vibrio parahaemolyticus, characterized in that it includes the following primers:

[0041] F3 primer: GAC GTA CCA TGT ACT AGA TC;

[0042] Primer B3: GCC ATC ACTAGC CAT AGC G;

[0043] FIP primers:

[0044] CGA TCG CCA GCA TGC GCG GCA TGT CTA TTG GTG AGA GGT CTTG;

[0045] BIP primers:

[0046] CAT GAT TTC AAT GAC GTC CCA TTC TGAACC CAAAAT CCG GGC.

[0047] Utilize above-mentioned primer to detect Vibrio parahaemolyticus, specifically as follows:

[0048] (101) Extract template DNA from the sample to be tested

[0049] The sample to be tested was cultivated with 3% sodium chloride alkaline peptone water enrichment solution, and the sample to be tested was cultured with the enrichment solution to obtain the enrichment solution to be tested. Take 1mL of the enrichment solution to be tested and add it to 1.5mL sterile cent...

Embodiment 2

[0064] In this example, the feasibility of the detection method provided in Example 1 is mainly verified, and the operations and results of the specificity experiment and the interference experiment are respectively given below.

[0065] 1. Specificity experiment. For the culture solution of the bacterial strains in Table 2 (confirmed by the national standard method), the following operations were performed respectively to verify the detection method provided in Example 1:

[0066] (201) Extract the template DNA to be tested from the bacterial strain: Take 1 mL of the culture solution of the bacterial strain and add it to a 1.5 mL sterile centrifuge tube, centrifuge at 7000×g for 2 min, discard the supernatant as much as possible; add 80 μL of the DNA extraction solution, mix well and boil in water Bath for 10 minutes, place on ice for 10 minutes; centrifuge at 7000×g for 2 minutes, the supernatant is the template DNA to be tested;

[0067] (202) According to the LAMP reaction...

Embodiment 3

[0080] In this example, the sensitivity experiment is mainly carried out on the detection method provided in Example 1, as follows:

[0081] Culture or adjust the Vibrio parahaemolyticus liquid to a McFarland turbidity of about 0.4, and then perform 10-fold gradient dilution with sterile water to obtain a dilution of 10 -1 -10 -10 10 kinds of vibrio parahaemolyticus liquids; respectively take 1mL of vibrio parahaemolyticus liquids of each gradient, and simultaneously take an equal volume of normal saline as a blank control, detect according to the detection method of embodiment one, and determine the detection method of embodiment one The detection limit of the method: take 1mL of Vibrio parahaemolyticus solution of each gradient, count the colonies by the plate counting method, take the plate with the number of colonies between 30 and 300 to calculate the number of colonies at each dilution; compare the LAMP reaction Result and colony count, determine the detection limit of ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a vibrio parahaemolyticus detection primer set comprising the primers of: F3 primer: GACGTACCATGTACTAGATC; B3 primer: GCCATCACTAGCCATAGCG; FIP primer: CGATCGCCAGCATGCGCGGCATGTCTATTGGTGAGAGGTCTTG; and BIP primer: CATGATTTCAATGACGTCCCATTCTGAACCCAAAATCCGGGC. The invention also provides a method for detecting vibrio parahaemolyticus by using the primer set. The detection method provided by the invention is rapid and reliable, and is advantaged in high specificity and good repeatability. With the method, a highly effective means is provided for vibrio parahaemolyticus detections.

Description

【Technical field】 [0001] The invention belongs to the field of food safety and relates to a loop-mediated isothermal amplification technology, in particular to a primer set and method based on the detection of Vibrio parahaemolyticus. 【Background technique】 [0002] Vibrio parahemolyticus (Bibrio Parahemolyticus), also known as halophilic bacillus, belongs to non-cholerae vibrio. Clinically, the main symptoms are acute onset, abdominal pain, vomiting, diarrhea and watery stool, and Vibrio parahemolyticus is the most common Parahaemolyticus is a food-borne bacterial pathogen that often occurs in a variety of foods such as aquatic products and pickled products. It is particularly serious in old breeding areas such as Guangdong, Guangxi, Hainan, Jiangsu, and Zhejiang, and has become an important food source in my country. Sexual pathogens. [0003] The traditional detection method of Vibrio parahaemolyticus is a simple microbial multiplication step, which is specific to pathogen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/04C12N15/11
CPCY02A50/30
Inventor 冯家望王小玉胡松楠郑立新游淑珠邝筱珊
Owner 冯家望
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More