Unlock instant, AI-driven research and patent intelligence for your innovation.

A kind of Sindbis virus xj-160 defective replicon and its construction method and application

A technology of XJ-160, a construction method, applied in biochemical equipment and methods, introduction of foreign genetic material using vectors, determination/inspection of microorganisms, etc., can solve problems such as detection of undiscovered Sindbis virus replicon alphavirus, etc.

Inactive Publication Date: 2016-01-20
STATION OF VIRUS PREVENTION & CONTROL CHINA DISEASES PREVENTION & CONTROL CENT
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

After searching, no reports were found on alphavirus detection using defective Sindbis virus replicons

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of Sindbis virus xj-160 defective replicon and its construction method and application
  • A kind of Sindbis virus xj-160 defective replicon and its construction method and application
  • A kind of Sindbis virus xj-160 defective replicon and its construction method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0399] 1. Construction of XJ-160 viral plasmid-type replicon vector

[0400] (1) Method overview:

[0401] Using the XJ-160 virus infectious whole gene clone pBR-XJ160 as a template, use XJ 1 (+) and XJ 1 (-), XJ 2 (+) and XJ 2 (-), XJ 3 (+) and XJ 3 (-) Three pairs of primers carry out PCR, and the non-structural gene sequence of the virus is divided into three fragments for amplification: XJ1 (1-2527nt), XJ2 (2527-5161nt), XJ3 (5161-7562nt), and the primer sequence used for cloning is :

[0402] XJ 1 (+) GCTAGC ATTGACGGCGTAGTACACAC (NheI site) 1-20nt

[0403] XJ 1 (-)TGCTTA GGATCC CCGCGAAGTAC (BamHI site) 2527-2505nt

[0404] XJ 2 (+)TTCGCGG GGATCC TAAGCAGT (BamHI site) 2509-2529nt

[0405] XJ 2 (-) GAATTC CGTCCGCGGCAGGTGGC (EcoRI site) 5161-5138nt

[0406] XJ 3 (+)ATCCTGCCGCGGACG GAATTC CGCTT (EcoRI site) 5148-5174nt

[0407] XJ 3 (-) GCGGCCGC AGTAGGGGTGTTACAG (NotI site) 7562-7539nt

[0408] It was cloned into the downstream of the eukaryotic ex...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a sindbis virus XJ-160 defective replicon and a construction method and application thereof. The construction method comprises the steps of constructing an XJ-160 virus particle type replicon carrier pVa-XJ, constructing XJ-160 particle type replicons pVaXJ-EGFP and pVaXJ-GLUC containing reporter genes, constructing a XJ-160 defective replicon, utilizing Acl I restriction enzyme to respectively perform single digestion of the VaXJ-EGFP and the pVaXJ-GLUC and constructing defective particles pVaXJ-EGFP delta and pVaXJ-GLUC delta with 1139 base deletions at the positions of non-structural genes. The mechanism of the construction method is that due to the partial absence of non-structural genes regions, a large amount of the reporter genes cannot be expressed normally after cells are introduced into the defective replicon, and non-structural protein expressed by virus can remedy and react on expression of the large amount of the reporter genes caused by the defective replicon when alphavirus infection exists in the cells. The sindbis virus XJ-160 defective replicon can detect multiple types of alphavirus, has not reaction on non-alphavirus and is high in specificity and sensitivity and can detect 1PFU virus. Operation is simple and quick, required instruments are few, sustainability is strong, the virus is not required to be killed in detection, and the sindbis virus XJ-160 defective replicon is suitable for quick identification of the alphavirus.

Description

technical field [0001] The present invention relates to a Sindbis virus XJ-160 defective replicon and its construction method and application, in particular to a Sindbis virus defective replicon containing a reporter gene and its construction process, and the use of the defective replicon Methods for Alphavirus Detection Background technique [0002] Alphavirus (Alphavirus) is a class of arboviruses transmitted by mosquitoes, including more than 30 members, which can cause fever, rash, arthritis, severe encephalitis symptoms and even neurological disorders or death in humans or mammals. Pathogens that pose serious hazards to human health and public health. This genus of viruses has the characteristics of worldwide distribution and often causes pandemics. For example, Chikungunya fever caused by Chikungunya Virus (Chikungunya Virus, CHIK) has repeatedly broken out in Africa, Asia and the Indian subcontinent since 1999; Western equine encephalitis, eastern equine encephaliti...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/63C12N15/65C12Q1/70C12Q1/66C12Q1/02G01N21/64
Inventor 梁国栋朱武洋付士红
Owner STATION OF VIRUS PREVENTION & CONTROL CHINA DISEASES PREVENTION & CONTROL CENT