Supercharge Your Innovation With Domain-Expert AI Agents!

Method for producing novel hipsc by means of sirna introduction

An inducer and pluripotent stem cell technology, applied in the field of new hiPSC production method using miRNA introduction, can solve the problem of hTERTmRNA expression reduction and other problems

Inactive Publication Date: 2013-05-08
TOTTORI UNIVERSITY
View PDF4 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, Non-Patent Document 4 reports that the expression of hTERT mRNA correlates with RGM249 mRNA, and that the expression of hTERT mRNA is reduced by shRNA or siRNA targeting RGM249 mRNA

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for producing novel hipsc by means of sirna introduction
  • Method for producing novel hipsc by means of sirna introduction
  • Method for producing novel hipsc by means of sirna introduction

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0176]

[0177] (1-1) Production of RGM249shRNA

[0178] According to Stealth RNAi designer (Invitrogen, California, USA), the sequence of RGM249shRNA was designed, and a vector (RGM249shRNA plasmid) for producing RGM249shRNA was produced using BLOCK-it Inducible H1RNAi Entry Vector (Invitrogen, California, USA). This RGM249shRNA is a small RNA designed to induce RNAi against RGM249mRNA in vivo.

[0179] Here, the base sequence of RGM249 mRNA is

[0180] 5’-GGAAAACUAAAAUGAGAGAAUGGGUGUCCAAGAGGACAAGUUCAUGCUCACCCGGUGAUGAGAGUUUGAUUGCAGAAUAAGGCUAGACAAAGGGAAGCUGAACAUGACCAAAGCCAUGUGACAUCGUAUGAUCCUCGAAUCUCACAGUAUCUAUGUAUCUAUAAUCAGAUACAUCCCUAGACUUUCCAGGAAUUCUGGUACUUCACGAGGAUGUGAGAAGACUCUGAACAAAAUAAUACACUGCUCGUG-3’(序列号7)。

[0181] In the upper strand of the RGM249shRNA plasmid, the sequence encoding RGM249shRNA is

[0182] 5'-CACCGCAGAATAAGGCTAGACAAAGCGAACTTTGTCTAGCCTTATTCTGC-3' (SEQ ID NO: 11). In the lower strand, the sequence forming a double strand with the upper strand is 5'-A...

Embodiment 2

[0202]

[0203] (2-1) Structure of miR-47siRNA, miR-101siRNA, miR-197siRNA

[0204] RGM249 was linked to the pRNAT-U6.1 / neo vector (GenScript USA, NJ, USA). RGM249 mRNA generated by T7 RNA polymerase was digested with RNA endonuclease III (Genlantis, CA, USA). The miRNA was fractionated by mirVANA miRNA Isolation Kit (Ambion, Japan, Tokyo, Japan), and purified by miRNA Isolation Kit (Wako Pure Chemical Industries, Ltd., Tokyo, Japan) using human anti-Ago2 microbeads. In addition, since there was a possibility that the small RNA did not bind to Ago2, purification was not performed using anti-Ago2. The digested small RNAs were cloned using the miRCAT-microRNA Cloning Kit (Integrated DNA Technologies, Iowa, USA), and sequenced using the TOPO vector (Invitrogen, California, USA). Additionally, secondary structures are predicted (http: / / rna.tbi.univie.ac.at / cgi-bin / RNAfold.cgi). Using miRBas, study the sequence identity of small RNAs. From the above results, three miRNAs, miR...

Embodiment 3

[0218]

[0219] (3-1) Subcutaneous administration of siRNA

[0220] Subcutaneous administration of 3 siRNA mixtures + DDS showed inhibition of proliferation of HMV-I cells compared to control administration of DDS alone (PTM ). 3 siRNA mixes and DDS were mixed at 100 μM each according to the manufacturer's protocol. The photographs shown in the upper part of FIG. 4 are photographs when a non-RNA-containing collagen (mock) was subcutaneously injected. The photographs shown in the lower part are photographs when 3 siRNA mixtures + DDS were subcutaneously injected. *Indicates that there is a significant difference between the case without RNA and the case with siRNA (P<0.01). Additionally, control mice displayed multiple nodules in the lungs (15.8 ± 1.9 nodules) and intraperitoneal cavity (0.8 ± 0.6 nodules) (Table 2). Several metastatic lesions were observed intraperitoneally as well as extraperitoneally, and subcutaneous infiltration was also observed.

[0221] 【Table 2】 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A novel compound to induce a pluripotent stem cell is provided. A novel anti-malignant-tumor substance is provided. A pluripotent stem cell-inducing agent, including one or more single-stranded or double-stranded polynucleotides selected from the group consisting of: a) a single-stranded or double-stranded polynucleotide containing a sequence of SEQ ID NO:1 or a sequence including deletion, substitution, or addition of 1 to 3 bases in SEQ ID No: 1, b) a single-stranded or double-stranded polynucleotide containing a sequence of SEQ ID NO:2 or a sequence including deletion, substitution, or addition of 1 to 3 bases in SEQ ID No: 2, c) a single-stranded or double-stranded polynucleotide containing a sequence of SEQ ID NO:3 or a sequence including deletion, substitution, or addition of 1 to 3 bases in SEQ ID No: 3, in which the pluripotent stem cell-inducing agent induces a cell to become a pluripotent stem cell is provided.

Description

【Technical field】 [0001] The present invention relates to novel small RNA (small RNA), pluripotent stem cell inducer, malignant tumor therapeutic drug or pluripotent stem cell and the like. 【Background technique】 [0002] The production technology of iPS cells is a field that has attracted a lot of attention in the medical industry in recent years. As a representative technique for producing iPS cells, the method described in Patent Document 1 can be cited. This document describes that iPS cells are produced by introducing four genes (Oct3 / 4, Klf4, Sox2, and c-Myc) into cells. Since the development of this technology, the number of reports of research results related to iPS cells has rapidly increased. For example, Patent Document 2 describes that iPS cells are produced by introducing three genes (Oct3 / 4, Klf4, Sox2) and one miRNA (hsa-miR-372, etc.) into cells. Non-Patent Document 1 describes that when the above-mentioned four or three genes are introduced, if the p53 ge...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113A61K31/7105A61K31/713A61K38/00A61K48/00A61P35/00C12N5/10A61P43/00C12N5/0775C12N15/09C12N15/11
CPCC12N2501/65C12N2320/30C12N15/113C12N5/0696C12N2310/14A61K31/7105C07H21/02A61K31/713C12N15/111C12N2310/11A61P1/16A61P1/18A61P11/00A61P17/00A61P21/00A61P25/00A61P35/00A61P43/00A61K2300/00
Inventor 三浦典正
Owner TOTTORI UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com