Unlock instant, AI-driven research and patent intelligence for your innovation.

Fluorescent quantitative RT-PCR (Reverse Transcription-Polymerase Chain Reaction) kit applied to avian pneumovirus A-subgroup specificity detection, and application of fluorescent quantitative RT-PCR kit

A poultry lung virus, fluorescent quantitative technology, applied in the field of fluorescent quantitative RT-PCR detection kits, fluorescent quantitative RT-PCR kits, can solve the problems of insufficient sensitivity, specificity and timeliness

Active Publication Date: 2014-11-05
HARBIN VETERINARY RES INST CHINESE ACADEMY OF AGRI SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the routine laboratory diagnosis method of APV is mainly RT-PCR, but this method is still insufficient in sensitivity, specificity and timeliness when used for APV detection, especially in the early diagnosis of the disease. especially obvious

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fluorescent quantitative RT-PCR (Reverse Transcription-Polymerase Chain Reaction) kit applied to avian pneumovirus A-subgroup specificity detection, and application of fluorescent quantitative RT-PCR kit
  • Fluorescent quantitative RT-PCR (Reverse Transcription-Polymerase Chain Reaction) kit applied to avian pneumovirus A-subgroup specificity detection, and application of fluorescent quantitative RT-PCR kit
  • Fluorescent quantitative RT-PCR (Reverse Transcription-Polymerase Chain Reaction) kit applied to avian pneumovirus A-subgroup specificity detection, and application of fluorescent quantitative RT-PCR kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Design and synthesis of probe and primer sequence in embodiment 1 kit of the present invention

[0022] According to the G gene sequence of subgroup A of APV in GenBank (GenBank accession number is GA:AY640317.1), design a pair of upstream and downstream primers for the target gene:

[0023] Upstream primer GAF: 5'GGTACATATTGGCTATAGTC3'

[0024] Downstream primer GAR: 5'CTCCTCCATTGTAGTTTCTGCACTCC3'

[0025] And 1 specific Taqman probe:

[0026] Probe GA: 5'FAM-GTTAGCGTCATAGTTGAACAGTCAGTGTTAG-TAMRA3'.

[0027] Primers were synthesized by Beijing Liuhe Huada Gene Company, and probes were synthesized by TaKaRa Company.

Embodiment 2

[0028] Example 2 Application of the kit of the present invention in the detection of avian pneumovirus (APV) A subgroup virus

[0029] 1 Materials and methods

[0030] 1.1 Strains and plasmids

[0031] E.coli DH5α is preserved by our laboratory, and the G genes of the four subgroups of APV (GenBank accession numbers are G A : AY640317.1, G B : AB548428.1, G C : AY590688.1, G D : AJ251085.1) was biosynthesized by Harbin Boshi and cloned into pBluescript IIKS (+) vector, respectively named as PBL-G A , PBL-G B , PBL-G C , PBL-G D maintained by the laboratory.

[0032] 1.2 Instruments and reagents

[0033]LightCycler480 fluorescent quantitative PCR instrument was purchased from Roche Company, UV spectrophotometer was purchased from GE Company; plasmid extraction kit was purchased from AxyGen Company; OneStep RT-PCR kit and Probe RT-PCR kit was purchased from Qiagen, and T7RNA polymerase was purchased from Pragma.

[0034] 1.3 Design and synthesis of probes

[0035] P...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a fluorescent quantitative RT-PCR (Reverse Transcription-Polymerase Chain Reaction) kit applied to avian pneumovirus A-subgroup specificity detection. The kit is characterized by comprising a specificity primer pair and a probe of a specifically amplified avian pneumovirus A-subgroup G-gene, wherein the nucleotide sequences of two primers in the primer pair are respectively shown in SEQ ID NO.1 and SEQ ID NO.2; and the probe sequence is shown in SEQ ID NO.3. By utilizing the kit, the detection on avian pneumovirus A-subgroup viruses can be realized; the kit has good linear relationship within 1*10<3> to 1*10<9> copy.mu L<-1>, the sensitivity is as high as 102 copy.mu L<-1>, that is, the sensitivity is 100 times that of an ordinary RT-PCR method; and moreover the kit has no cross reaction with other poultry disease viruses. The result shows that the kit disclosed by the invention has good sensitivity and specificity, and can be applied to quantitative detection on the avian pneumovirus A-subgroup.

Description

technical field [0001] The invention relates to a fluorescent quantitative RT-PCR detection kit, in particular to a fluorescent quantitative RT-PCR kit for specific detection of subgroup A of avian pneumovirus and its application, belonging to the field of virus detection. Background technique [0002] Avian pneumonia virus (Avian pneumovirus, APV) is also called turkey rhinotracheitis virus (turkyrhinotracheits virus, TRTV). Avian pneumoviruses belong to the family Paramyxoviridae, the subfamily Pneumoviridae, and the subgenus Metapneumoviridae. Diseases caused by avian pneumovirus were first identified in turkeys, where the virus caused respiratory disease and decreased egg production. Avian pneumovirus is an important factor causing swollen head syndrome in chickens, but the lethality rate of APV is not high (2% to 5%). Since APV was first reported in South Africa in 1978, APV has been reported many times in Europe and the Middle East. In many parts of the world, APV po...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/70C12Q1/68C12R1/93
Inventor 高玉龙王笑梅秦立廷王永强祁小乐高宏雷
Owner HARBIN VETERINARY RES INST CHINESE ACADEMY OF AGRI SCI