Fluorescent quantitative RT-PCR (Reverse Transcription-Polymerase Chain Reaction) kit applied to avian pneumovirus A-subgroup specificity detection, and application of fluorescent quantitative RT-PCR kit
A poultry lung virus, fluorescent quantitative technology, applied in the field of fluorescent quantitative RT-PCR detection kits, fluorescent quantitative RT-PCR kits, can solve the problems of insufficient sensitivity, specificity and timeliness
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0021] Design and synthesis of probe and primer sequence in embodiment 1 kit of the present invention
[0022] According to the G gene sequence of subgroup A of APV in GenBank (GenBank accession number is GA:AY640317.1), design a pair of upstream and downstream primers for the target gene:
[0023] Upstream primer GAF: 5'GGTACATATTGGCTATAGTC3'
[0024] Downstream primer GAR: 5'CTCCTCCATTGTAGTTTCTGCACTCC3'
[0025] And 1 specific Taqman probe:
[0026] Probe GA: 5'FAM-GTTAGCGTCATAGTTGAACAGTCAGTGTTAG-TAMRA3'.
[0027] Primers were synthesized by Beijing Liuhe Huada Gene Company, and probes were synthesized by TaKaRa Company.
Embodiment 2
[0028] Example 2 Application of the kit of the present invention in the detection of avian pneumovirus (APV) A subgroup virus
[0029] 1 Materials and methods
[0030] 1.1 Strains and plasmids
[0031] E.coli DH5α is preserved by our laboratory, and the G genes of the four subgroups of APV (GenBank accession numbers are G A : AY640317.1, G B : AB548428.1, G C : AY590688.1, G D : AJ251085.1) was biosynthesized by Harbin Boshi and cloned into pBluescript IIKS (+) vector, respectively named as PBL-G A , PBL-G B , PBL-G C , PBL-G D maintained by the laboratory.
[0032] 1.2 Instruments and reagents
[0033]LightCycler480 fluorescent quantitative PCR instrument was purchased from Roche Company, UV spectrophotometer was purchased from GE Company; plasmid extraction kit was purchased from AxyGen Company; OneStep RT-PCR kit and Probe RT-PCR kit was purchased from Qiagen, and T7RNA polymerase was purchased from Pragma.
[0034] 1.3 Design and synthesis of probes
[0035] P...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 