Brown Botrytis and Its Application

A technology of botrytis braziliana and algae strains, applied in the field of microbial engineering, can solve the problems of slow growth of botrytis, low total hydrocarbon content, and limited application, and achieve the effects of high hydrocarbon content, fast growth speed, and high biomass

Active Publication Date: 2016-01-13
ENN SCI & TECH DEV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Botrytis in the prior art has disadvantages such as slow growth rate, low biomass, and low total hydrocarbon content, which limits its application in industrialization

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Brown Botrytis and Its Application
  • Brown Botrytis and Its Application
  • Brown Botrytis and Its Application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1 Separation, purification and screening of algae strains

[0040] Method 1: Add 1 / 3 volume of BG11 medium (see Table 1 for the formula) to the pond water sample retrieved from Hainan area, culture for about one month, draw 20-100μL of water sample and drop it on the glass slide, use 40 times Or observe with a microscope at 100 times, move the Botryococcus algae cells into the middle of the field of view, use a glass capillary with an inner diameter of 0.9 to 1.1 mm to burn it with an alcohol lamp outside flame for 1 to 5 seconds and then quickly stretch it. The diameter of the capillary is pulled to about 100 μm. Directly suck the algae cells under the microscope field and inoculate them in a 48-well culture plate containing BG11 medium (see Table 1 for the formula) at 25°C and a light intensity of 50 μmol / m 2 ·Cultivate for about 3 weeks under the condition of s, observe under microscope, select wells with only single algae strains, pave the plate or streak the pl...

Embodiment 2

[0047] Example 2 Classification and identification

[0048] (1) Shape identification

[0049] Observed under a microscope, ENN41 algae cells are elliptical or wedge-shaped and appear as clusters of colonies; cell size: 6μm~8μm in length, 5μm~7μm in width, and aggregate population over 50μm; cell color is black-green or yellow-brown; cell pack It is covered in a translucent group of glues with irregular branches or leaves; two spore-like spores are often formed during cell division, and the group is often broken into small groups. The strain was preliminarily identified as Botryococcus braunii.

[0050] Microscopic examination pictures such as figure 2 Shown.

[0051] (2) Molecular identification:

[0052] 18S sequence amplification adopts eukaryotic 18S amplification universal primers (primer synthesis is synthesized by Shanghai Shenggong Biological Engineering Company).

[0053] Primer 15’CCTGGTTGATCCTGCCAG3’

[0054] Primer 25’TTGATCCTTCTGCAGGTTCA3’

[0055] PCR amplification obtains ...

Embodiment 3

[0072] Example 3 Growth in a 3cm column reactor

[0073] The ENN41 algae strain in the logarithmic growth phase was inoculated into the prepared BG11 medium (see Table 1 for the formula) to make the cell density reach OD 750 Is 0.3. The reactor used for the culture is a column reactor with an inner diameter of 30 mm and a length of 600 mm. The light intensity gradually increases according to the cell state and density, and the light intensity is controlled at 50~500μmol / m during the culture process 2 ·S. 24 hours of light, during the culture period, the pH value of the culture medium is adjusted between 7-9 by passing 1.5-2% carbon dioxide and air mixed gas into the culture solution. The temperature is regulated in the range of 20-35℃. During the cultivation process, samples are taken regularly to determine the dry weight, and the results are shown in Figure 5 . The ENN41 algae strain was cultured in the general BG11 medium for 16 days, and the dry weight reached 8.40g / L on t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
clearance rateaaaaaaaaaa
Login to View More

Abstract

The invention discloses botryococcus braunii ENN41 with collection number CGMCC No.5149. The botryococcus braunii ENN41 disclosed by the invention has the advantages of high biomass, high hydrocarbon content, high growth rate and high culture density, and is suitable for industrialization application. The invention also discloses an application of the botryococcus braunii ENN41 to biofuels and particularly to biological hydrocarbon, biological diesel or biological kerosene, an application to wastewater treatment, waste gas treatment and CO2 emission reduction, and an application to the production of pigment and animal feed.

Description

Technical field [0001] The present invention relates to the field of microbial engineering, in particular, the present invention relates to a kind of Botryococcus braunii and its application. Background technique [0002] With the shortage of global fossil energy and the environmental problems it brings, it is imperative to find new alternative energy sources. Microalgae has the characteristics of large biomass, short growth cycle and high oil content. 2 Both emission reduction and biofuel utilization have broad development prospects. [0003] At present, there are two main research and development ideas for using microalgae to produce biodiesel. One is to use the fatty acid synthesized by microalgae to produce biofuel through esterification. Because most microalgae can accumulate a large amount of oil through fatty acid synthesis pathway, the current microalgae energy Most researches use this kind of research and development ideas to develop microalgae biofuels; the other is to us...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N1/12C12P5/00C12P7/64C02F3/32B01D53/84C12P23/00A23K1/16C12R1/89
CPCY02A50/20Y02E50/10Y02P20/59
Inventor陈传红吴洪尹顺吉马建源
OwnerENN SCI & TECH DEV