Cancer screening test kit

A technology for detecting sets and specimens, which can be used in the determination/inspection of microorganisms, biochemical equipment and methods, etc., and can solve problems such as obstacles to testing methods

Inactive Publication Date: 2014-03-12
湖南宏雅基因技术有限公司
View PDF7 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the theory of gene methylation detection has been developed for a long time, it is also widely used by academic researchers. However, if it is to be applied to clinical related fields such as medical detection, the stability and repeatability of the test are very important, and methylation gene detection At present, it has not been widely used in medical testing. Part of the reason is that in addition to the need for a large number of studies to support the clinical significance and related verification of the labeled gene, there are also considerable technical obstacles in how to provide a stable testing method.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cancer screening test kit
  • Cancer screening test kit
  • Cancer screening test kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Embodiment one material and method

[0037] Samples, first extract their DNA, after the conversion of bisulfite, and reveal in Table 1 to Table 4 that it can be used to amplify the methylation of PAX1, ZNF582, SOX1, NKX6-1 and the internal control group Primer pairs and probe sets (such as Table 1 to Table 5) for the region are used for detection. The main components of the kit are shown in Table 6:

[0038] Table 1 Primer pairs and probe sets used to amplify the methylated region of the target gene PAX1

[0039] ID No.:

PAX1 primer pair and probe set

SEQ ID No: 1

5'attcgcgcgttttcggcgtga 3'

SEQ ID No: 2

5'gttaaattgattttcgtacgttgtag 3'

SEQ ID No: 3

5'tattttgggtttggggtcgc 3'

SEQ ID No: 4

5'ttattttgggtttggggtcgcg 3'

SEQ ID No: 5

5'gggcggtagcgcgtttcgtt3'

SEQ ID No: 6

5'tagcggcggcggtaggttttgga 3'

SEQ ID No: 7

5'gtagtgacgggaattaatgagt 3'

SEQ ID No: 8

5'aacatcccacgaccacgccg 3...

Embodiment 2

[0053] Example 2 Analysis of Methylation Degree of Target Genes in Different Cancer Cell Lines

[0054]This test uses the primer pairs and probe sets disclosed in Table 1 to Table 4 that can be used to amplify the methylated regions of PAX1, ZNF582, SOX1 and NKX6-1 to detect different cancer cell lines and analyze their methylation status The results are shown in Table 7. The results showed that in the cervical cancer-related cell line Hela, PAX1, ZNF582, SOX1 and NKX6-1 were all detected to be methylated; in the cervical cancer-related cell line SiHa, PAX1, ZNF582 and SOX1 were detected There is methylation; in the cell line CaSki related to cervical cancer, methylation was detected in PAX1, ZNF582, SOX1 and NKX6-1; in the cell line C-33A related to cervical cancer, ZNF582, SOX1 and NKX6 -1 Methylation detected. In the colorectal cancer-related cell line COLO 205, methylation was detected in PAX1, ZNF582, SOX1, and NKX6-1; in the colorectal cancer-related cell line Caco-2, ...

Embodiment 3

[0058] Example 3 Analysis of Methylation Degree of Target Genes in Cervical Cancer Samples

[0059] This test uses 279 normal and diseased Pap smear samples from Taiwan with known diagnoses. CIN2) 2 (0.7%), severe (CIN3) / carcinoma in situ (CIS) 12 (4.3%), squamous cell carcinoma 4 (1.4%), and their DNA was extracted, after bisulfite ( bisulfite), and use the primer pairs and probe sets disclosed in Table 1 to Table 4 that can be used to amplify PAX1, ZNF582, SOX1 and NKX6-1 methylated regions for detection. As shown in Table 9, compared with normal Pap smear samples, the Pap smear samples with PAX1, ZNF582, SOX1 and NKX6-1 as the target genes were 85.45 times more detected (95% confidence interval = 33.95~ 215.11), 289.17 times (95% confidence interval = 39.20-2133.14), 67.69 times (95% confidence interval = 20.55-223.01) and 2.56 times (95% confidence interval = 1.36-4.82) times the risk of developing severe cervical cancer. As shown in Table 10, when individual methylation...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to a cancer biomarker molecule, a screening test kit and a detection method thereof. According to the present invention, analysis of methylating areas of specimen target genes PAX1, ZNF582, SOX1 and NKX6-1 are adopted, plural of segments of target gene-specific oligonucleotide primers or probes are designed, and the oligonucleotide probes are adopted to detect presence or absence of methylation of the target genes so as to further determine possibility of cancer occurrence; and the methylation state detection method comprises methylation-specific PCR (MSP), quantitative methylation-specific PCR (QMSP), bisulfite sequencing (BS), microarrays, mass spectrometer, denaturing high-performance liquid chromatography (DHPLC), pyrosequencing or Enzyme-linked immunosorbent assay (ELISA) and the like.

Description

technical field [0001] The invention relates to a cancer biomarker molecule and a test set for screening. By analyzing the target gene methylation region of a sample, several oligonucleotide primers or probes specific to the target gene are designed. Specific oligonucleotides detect the presence or absence of methylation of the target gene to determine the possibility of cancer. Background technique [0002] According to the World Health Organization survey results in 2008, cancer is one of the top ten causes of death in the world. Men have higher mortality rates from lung cancer, liver cancer, stomach cancer, colorectal cancer, and oral cancer; women have higher mortality rates from breast cancer, lung cancer, and cervical cancer. Cancer and colorectal cancer have a high mortality rate. Therefore, researchers from all over the world are actively researching methods for early preventive detection or cancer prognosis detection, and if most early cancers can be screened out e...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
CPCC12Q1/6886C12Q2600/154
Inventor张绮芬王惠贞刘禹利
Owner湖南宏雅基因技术有限公司