Cancer screening test kit
A technology for detecting sets and specimens, which can be used in the determination/inspection of microorganisms, biochemical equipment and methods, etc., and can solve problems such as obstacles to testing methods
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Embodiment one material and method
[0037] Samples, first extract their DNA, after the conversion of bisulfite, and reveal in Table 1 to Table 4 that it can be used to amplify the methylation of PAX1, ZNF582, SOX1, NKX6-1 and the internal control group Primer pairs and probe sets (such as Table 1 to Table 5) for the region are used for detection. The main components of the kit are shown in Table 6:
[0038] Table 1 Primer pairs and probe sets used to amplify the methylated region of the target gene PAX1
[0039] ID No.:
PAX1 primer pair and probe set
SEQ ID No: 1
5'attcgcgcgttttcggcgtga 3'
SEQ ID No: 2
5'gttaaattgattttcgtacgttgtag 3'
SEQ ID No: 3
5'tattttgggtttggggtcgc 3'
SEQ ID No: 4
5'ttattttgggtttggggtcgcg 3'
SEQ ID No: 5
5'gggcggtagcgcgtttcgtt3'
SEQ ID No: 6
5'tagcggcggcggtaggttttgga 3'
SEQ ID No: 7
5'gtagtgacgggaattaatgagt 3'
SEQ ID No: 8
5'aacatcccacgaccacgccg 3...
Embodiment 2
[0053] Example 2 Analysis of Methylation Degree of Target Genes in Different Cancer Cell Lines
[0054]This test uses the primer pairs and probe sets disclosed in Table 1 to Table 4 that can be used to amplify the methylated regions of PAX1, ZNF582, SOX1 and NKX6-1 to detect different cancer cell lines and analyze their methylation status The results are shown in Table 7. The results showed that in the cervical cancer-related cell line Hela, PAX1, ZNF582, SOX1 and NKX6-1 were all detected to be methylated; in the cervical cancer-related cell line SiHa, PAX1, ZNF582 and SOX1 were detected There is methylation; in the cell line CaSki related to cervical cancer, methylation was detected in PAX1, ZNF582, SOX1 and NKX6-1; in the cell line C-33A related to cervical cancer, ZNF582, SOX1 and NKX6 -1 Methylation detected. In the colorectal cancer-related cell line COLO 205, methylation was detected in PAX1, ZNF582, SOX1, and NKX6-1; in the colorectal cancer-related cell line Caco-2, ...
Embodiment 3
[0058] Example 3 Analysis of Methylation Degree of Target Genes in Cervical Cancer Samples
[0059] This test uses 279 normal and diseased Pap smear samples from Taiwan with known diagnoses. CIN2) 2 (0.7%), severe (CIN3) / carcinoma in situ (CIS) 12 (4.3%), squamous cell carcinoma 4 (1.4%), and their DNA was extracted, after bisulfite ( bisulfite), and use the primer pairs and probe sets disclosed in Table 1 to Table 4 that can be used to amplify PAX1, ZNF582, SOX1 and NKX6-1 methylated regions for detection. As shown in Table 9, compared with normal Pap smear samples, the Pap smear samples with PAX1, ZNF582, SOX1 and NKX6-1 as the target genes were 85.45 times more detected (95% confidence interval = 33.95~ 215.11), 289.17 times (95% confidence interval = 39.20-2133.14), 67.69 times (95% confidence interval = 20.55-223.01) and 2.56 times (95% confidence interval = 1.36-4.82) times the risk of developing severe cervical cancer. As shown in Table 10, when individual methylation...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


