Real-time fluorescence PCR detection reagent for albonectria rigiduscula and detection method

A real-time fluorescence and cocoa flower gall technology, which is applied in the measurement/inspection of microorganisms, biochemical equipment and methods, etc., can solve the problem of time-consuming and laborious, high professional quality requirements for testing personnel, and it is difficult to meet the needs of fast, accurate and sensitive identification. Requirements and other issues to achieve the effect of improving sensitivity, avoiding interference from human factors, and avoiding false positives and false negatives

Active Publication Date: 2015-05-13
NINGBO ACAD OF SCI & TECH FOR INSPECTION & QUARANTINE +1
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, domestic and foreign methods for detecting cocoa gall disease are limited to morphological detection methods, which are time-consuming and labor-intensive, and require high professional quality of testing personnel, making it difficult to meet the detection requirements of rapid, accurate and sensitive identification

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0014] Embodiment 1, the design of the special-purpose primer and probe that detects cocoa flower gall

[0015] The gene sequences of cocoa flower gall pathogen and its close species were retrieved from GenBank, and DNAMAN6.0.40 software was used for comparison and analysis to find out the conserved gene sequence of cocoa flower gall pathogen. Express3.0 designed primers and TaqMan-MGB probes, and then compared the designed primers and probes on NCBI, and finally determined a pair of primers and a probe through screening. The sequence is: Primer NR-EFF: GAG CGA CGT TGG CAC AAT G; primer NR-EFR: GGT TCG GAA CAC GTG ACG AT; probe NR-EFMGB: CCT GGC CCC TGC AC, the 5' end of the probe contains a FAM reporter fluorescent dye, and the 3' end contains no The quencher group that fluoresces and has an MGB molecule.

Embodiment 2

[0016] Embodiment 2, real-time fluorescent RT-PCR detects the specificity test of cocoa flower gall pathogen

[0017] The specific process includes the following steps:

[0018] 1. Sample source

[0019] 3 pure culture samples of cocoa gall gall (F13657-1, F13657-2, F13657-3), 3 pure culture samples of Fusarium oxysporum (F1, F5, F7), 2 pure culture samples of Fusarium solani (F2, F8), 2 samples of pure culture of Fusarium trilineum (F4, F22), 2 samples of pure culture of Fusarium rubrum (F13, F27), 2 samples of pure culture of Fusarium equiseti (F9 , F31), 2 pure culture samples of Verticillium dahliae (VD1, VD2), 2 pure culture samples of Verticillium black and white (AV02, AV27). The sources of the above-mentioned strains are collected or collected by the inventors.

[0020] 2. Extraction of sample DNA

[0021] DNA was extracted from the samples in step 1 with DNA extraction kits. For specific operations, see the kit instructions.

[0022] 3. Specific detection

[002...

Embodiment 3

[0024] Embodiment 3, optimization of real-time fluorescent PCR reaction system

[0025] Using the DNA of F13657-1 obtained in step 2 of Example 2 as a template, the primer concentration and probe concentration in the real-time fluorescent PCR detection system were optimized respectively, and the specific steps are as follows:

[0026] 1. Primer concentration optimization

[0027]In the system of Step 3 in Example 2, the concentration of other components was kept constant, and the final concentration of the primer was increased by 0.1 μM from 0.1 μM to 1.0 μM. The reaction conditions were carried out according to the conditions of Step 3 in Example 2. The results showed that when the final primer concentration was 1.0μM, the ΔRn value reached the maximum and the Ct value was the minimum. After repeating the experiment three times, the final primer concentration was determined to be 1.0 μM.

[0028] 2. Probe concentration optimization

[0029] In the system of Step 3 in Exam...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a real-time fluorescence PCR detection reagent for albonectria rigiduscula and a detection method. The real-time fluorescence PCR detection reagent for the albonectria rigiduscula comprises a pair of specific primers and a specific fluorescent probe, wherein the nucleotide sequence of the forward primer is GAGCGACGTTGGCACAATG; the nucleotide sequence of the reverse primer is GGTTCGGAACACGTGACGAT; and the nucleotide sequence of the probe is CCTGGCCCCTGCAC. The detection method comprises the following steps: performing real-time fluorescence PCR by using the primers and the probe for detecting the albonectria rigiduscula and by taking the DNA of a to-be-detected sample as a template; and detecting a fluorescence signal of an amplification signal. The reagent and the method for detecting the albonectria rigiduscula are simple in operation, and quick, sensitive and accurate in detection.

Description

technical field [0001] The invention relates to a detection technology of cocoa flower gall pathogen, in particular to a real-time fluorescent PCR detection reagent and a detection method of cocoa flower gall pathogen. Background technique [0002] Cocoa gall fungus (Albonectria rigidiuscula (Berk. & Broome) Rossman & Samuels) belongs to Fungi (Fungi), Ascomycota (Ascomycota), Sordariomycetes (Sordariomycetes), Hypocreales (Hypocreales), Congchiaceae ( Nectriaceae), Albonectria. Its asexual stage is Fusarium decemcellulare Brick1908. It has been included in the list of imported plant quarantine pests in my country and is a quarantine plant pathogenic fungus. Currently, distributed in Australia, Russia, Belarus, Ukraine, Cameroon, Central Africa, Congo, Ghana, Côte d'Ivoire, Madagascar, Nigeria, Sierra Leone, Cuba, the United States, Costa Rica, Grenada, Guatemala, Honduras, Jamaica, Nicaragua, Panama, Trinidad , Tobago, Argentina, Colombia, Peru, French Guiana, Suriname, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/68C12Q1/04
CPCC12Q1/04C12Q1/686C12Q2561/113C12Q2561/101
Inventor段维军郭立新段丽君张慧丽陈先锋
OwnerNINGBO ACAD OF SCI & TECH FOR INSPECTION & QUARANTINE