Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Recombinant protein IGF (insulin-like growth factor) 1-24 and application thereof

A technology of recombinant proteins and drugs, applied in the field of genetic engineering, can solve problems such as unclear molecular mechanism of action, and achieve the effects of improving the quality of life, promoting damage repair, and promoting proliferation

Active Publication Date: 2014-04-02
CHONGQING UNIV
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The reason why MGF has different functions from other isoforms of IGF-1 is partly due to the 24 amino acids at the C-terminus of MGF (MGF-24), also known as MGF E peptide, which has been shown to activate human muscle satellite cells, promote Myon cell proliferation and other functions, but the exact molecular mechanism of action is still unclear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant protein IGF (insulin-like growth factor) 1-24 and application thereof
  • Recombinant protein IGF (insulin-like growth factor) 1-24 and application thereof
  • Recombinant protein IGF (insulin-like growth factor) 1-24 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Embodiment 1, the acquisition of recombinant protein IGF1-24

[0032] The IGF1-24 gene was amplified by the overlap PCR method. The PCR primer sequences are as follows:

[0033] IGF1-24a F: 5'CGCGGATCCGGACCGGAGACGCTCTGC3' (SEQ ID No. 3);

[0034] IGF1-24bR: 5'CTGATAACCGCCACCAGCTGACTTGGCAGGCT3' (SEQ ID No. 4);

[0035] IGF1-24c F: 5'GGTGGCGGTTATCAGTATCAGCCCCCATCTA3' (SEQ ID No. 5);

[0036] IGF1-24d R: 5'CCGCTCGAGCTACTTTGTGTTCTTCAAATGT3' (SEQ ID No. 6).

[0037] Using the cDNA from human IGF-1Ec (GenBank Ax147742) as a template, the IGF1 gene was amplified with primers IGF1-24a F and IGF1-24bR, and the MGF-24 gene was amplified with primers IGF1-24c F and IGF1-24d R; Using the obtained IGF1 gene and MGF-24 gene as a common template, the primers IGF1-24a F and IGF1-24d R were used for PCR amplification to obtain the IGF1-24 gene with BamHI and XhoI restriction sites at both ends. After the DNA fragment was digested with BamHI and XhoI, it was ligated with the plasmid...

Embodiment 2

[0039] Example 2. Recombinant protein IGF1-24 promotes the proliferation, differentiation, adhesion and migration of myoblasts

[0040] Mouse myoblasts C2C12 were treated with DMEM medium containing 10% fetal bovine serum at a temperature of 37°C, saturated humidity, and CO 2 Incubated at a gas volume fraction of 0.05.

[0041] C2C12 cells were inoculated into 96-well plates, cultured overnight, and then cultured in DMEM high-glucose medium containing 2% fetal bovine serum and 50ng / mL IGF1-24, and the medium was changed every day. After 48 hours, CCK-8 was used to detect cell proliferation. At the same time, set blank control, IGF-1 control and MGF-24 control respectively. The result is as figure 2 As shown, the recombinant protein IGF1-24 can promote the proliferation of C2C12 cells, and the effect is equivalent to that of IGF-1, while MGF-24 hardly promotes the proliferation of C2C12 cells.

[0042] C2C12 cells were inoculated into 96-well plates, cultured overnight, and...

Embodiment 3

[0048] Example 3. Recombinant protein IGF1-24 promotes the proliferation and migration of osteoblasts

[0049] Osteoblasts were obtained from neonatal rat skulls by the tissue block method, using DMEM / F12 medium containing 10% fetal bovine serum, 100 IU / mL penicillin and 100 μg / mL streptomycin, at a temperature of 37 °C, saturated humidity, CO 2 Incubated at a gas volume fraction of 0.05.

[0050] Inoculate osteoblasts into a 96-well plate and culture overnight, then culture the cells in serum-free DMEM / F12 medium containing 50ng / mL IGF1-24, change the medium every day, detect cell proliferation with CCK-8 after 48 hours, and set a blank control at the same time . The result is as Figure 10 As shown, the recombinant protein IGF1-24 can significantly promote the proliferation of osteoblasts.

[0051] Take a 24-well Transwell (8.0mm pore size) plate and inoculate 5×10 in the upper chamber containing 100 μL serum-free medium 4 For osteoblasts, 50ng / mL IGF1-24 was added to th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombinant protein IGF (insulin-like growth factor) 1-24, which has an amino acid sequence shown in SEQ ID No.2, and is obtained by connecting a C-end of an IGF-1 sequence and an N-end of an MGF (mechano growth factor)-24 sequence through three GLY connectors. A research result shows that the recombinant protein can promote proliferation, differentiation, conglutination and migration of myoblast, can promote proliferation and migration of osteocyte, can promote damage repair of a nerve cell, can also promote proliferation of a myocardial cell, is obviously stronger than IGF-1 and MGF-24 in effect, can be prepared into a drug, can be used for treating related diseases of muscles, bones, nerves, myocardial damages and the like, and plays a positive and important promotion role in improvement of the survival quality of a sufferer.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering and relates to a recombinant protein and its pharmaceutical use. Background technique [0002] Insulin-like growth factor-1 (IGF-1) is a single-chain polypeptide growth factor of the insulin family. Its structure is highly homologous to insulin, and it has cell differentiation, proliferation and insulin-like metabolism. Studies on IGF-1 have found that it plays an important role in growth disorders, diabetes, osteoporosis, kidney disease, cardiovascular disease, tumors and the central nervous system. [0003] Mechano growth factor (MGF) is a splice isoform of IGF-1. After the muscle is mechanically stimulated, the IGF-1 gene will be selectively spliced ​​to produce MGF, which can repair local muscle damage by activating muscle satellite cells and anabolic pathways. The reason why MGF has different functions from other isoforms of IGF-1 is partly due to the 24 amino acids at the C-ter...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/65C12N15/16C12N15/70C12N1/21A61K38/30A61P9/04A61P9/10A61P25/00A61P25/16A61P19/08A61P19/10A61P21/00
CPCA61K38/00C07K14/65
Inventor 唐丽灵易茜冯建国万荣雪曾慧欧梦婷
Owner CHONGQING UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com