Application of reagents for detecting mir-129-2 methylation in the preparation of kits for detecting breast cancer
A methylation and kit technology, applied in the field of molecular diagnosis, can solve problems such as insufficient specificity of ordinary PCR
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0015] experiment material:
[0016] Breast cancer cell lines MDA-MB-425, MDA-MB-468, and SK-BR-3 were purchased from the Cell Bank of the Type Culture Collection Committee of the Chinese Academy of Sciences;
[0017] 6 normal human tissue samples, provided by the cooperative hospital;
[0018] Normal adult chromosomal DNA and methylated DNA as controls were purchased from USBiological;
[0019] Primers were synthesized by Shanghai Introvigen;
[0020] All other materials used in the experiment were commercially available.
[0021] Experimental procedure:
[0022] Collect the cultured MDA-MB-425, MDA-MB-468, SK-BR-3 cell lines and extract DNA;
[0023] DNA extraction from plasma samples;
[0024] Unmethylated cytosine in DNA samples was converted to uracil using EpiTect sodium bisulfite kit (Qiagen, Hilden, Germany);
[0025] Using methylated primers
[0026] Forward primer: GAGTTGGGGGATCGCGGACGGT (SEQ ID NO: 1)
[0027] Reverse primer: ATATACCGACTTCTTCGATTCGCCG (SEQ I...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 