Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of Pavlova viridis delta-5 desaturase gene and preparation method for epa synthesis

A technology of Pavlova viridis and desaturase, applied in the field of desaturase gene and its separation, can solve the problems of sequence structure difference, enzyme activity and function difference, etc.

Active Publication Date: 2016-08-10
HEFEI UNIV OF TECH
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, several delta-5 desaturases from different species have been isolated and identified in eukaryotic microalgae, but the homologous enzymes of different species obviously have sequence and structural differences, which lead to their enzymatic activity. and function difference

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Pavlova viridis is a commonly used eukaryotic microalgae, which was purchased from the Institute of Oceanology, Chinese Academy of Sciences.

[0021] The specific operation steps for preparing the Pavlova viridis delta-5 desaturase gene are as follows:

[0022] (1) Obtain the genomic DNA and total mRNA of Pavlova viridis from Pavlova viridis (Pavlova. viridis) by using conventional DNA and RNA extraction and separation means in the art;

[0023] (2) The conservation region amplification process of the delta-5 desaturase gene is as follows:

[0024] (2.1) Using 5 μl of RNA as a template, the first strand of cDNA was synthesized by reverse transcription using polythymidine oligonucleotide primer (oligo dT Primer): 5'-oligod(T)15GTAAAACGACGGCCAGT-3';

[0025] (2.2) Using the above-mentioned first strand of cDNA as a template, and according to the conservatism of the delta-5 desaturase homologous gene, an upstream primer P3F and a downstream primer P3R are designed to ampl...

Embodiment 2

[0050] In order to verify the function of the above delta-5 desaturase gene, the first strand of cDNA was synthesized by reverse transcription using oligo dT Primer: 5'-oligod(T)15GTAAAACGACGGCCAGT-3' using the mentioned mRNA as a template, and used it as a clone delta- 5 Templates for expressing genes. Then, according to the obtained delta-5 full-length gene sequence, the upstream primer TAGGATTCATGGCTCCGCGCGACGCTTACACG and the downstream primer AAGCGGCCGCTTAGTGCTTGTGCTCGTGCACG were designed respectively, and amplified under the conditions of 94oC 3min; 94oC 30s, 60oC 30s, 72oC 1.5min, 30 cycles; 72oC 10min PCR conditions Express gene fragments. Subsequently, the fragment was connected to the vector pPIC3.5k by subcloning methods commonly used in the art to obtain the Pichia pastoris expression plasmid pPIC3.5k-delta-5, and then the plasmid and the empty vector were respectively electrotransformed into Pichia pastoris to obtain GS115 -5 and GS115-pPIC3.5K. Pick positive tra...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a Pavlova viridis delta-5 desaturase gene used for EPA synthesis, the DNA sequence of which is SEQ ID No.1. The preparation method is as follows: firstly, the genomic DNA of Pavlova viridis is isolated from Pavlova viridis; then, using the genomic DNA of Pavlova viridis as a template, a degenerate design is made according to the sequence of the conserved histidine box of the desaturase gene primers, so as to amplify the gene in the conserved region; next, carry out chromosome walking on the 5' end and 3' end respectively to obtain the whole gene sequence, and obtain the full length of the gene by ordinary PCR. The acquisition of this gene provides a basis for further understanding and utilization of the very practical DHA synthesis process.

Description

technical field [0001] The invention belongs to the technical field of gene cloning and separation, and in particular relates to a desaturase gene related to polyunsaturated fatty acid synthesis derived from eukaryotic microalgae and a separation method thereof. Background technique [0002] Polyunsaturated fatty acids are essential nutrients for the human body, and eukaryotic microalgae are important biological resources because they are rich in polyunsaturated fatty acids. Pavlova viridis is rich in EPA (eicosapentaenoic acid) and DHA (docosahexaenoic acid). This microalgae is a good experiment for the identification and cloning of polyunsaturated fatty acid-related synthesis genes. Material. [0003] The full name of SEFA-PCR is self-formed adapter PCR, which is a kind of PCR technology that completes chromosome walking by forming an aptamer by "backward" with primers. Compared with other technologies such as inverse PCR, SEFA-PCR has the advantages of long amplified fr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/53C12N15/10
Inventor 徐毅汪惠丽
Owner HEFEI UNIV OF TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com