A kind of Pavlova viridis delta-5 desaturase gene and preparation method for epa synthesis
A technology of Pavlova viridis and desaturase, applied in the field of desaturase gene and its separation, can solve the problems of sequence structure difference, enzyme activity and function difference, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0020] Pavlova viridis is a commonly used eukaryotic microalgae, which was purchased from the Institute of Oceanology, Chinese Academy of Sciences.
[0021] The specific operation steps for preparing the Pavlova viridis delta-5 desaturase gene are as follows:
[0022] (1) Obtain the genomic DNA and total mRNA of Pavlova viridis from Pavlova viridis (Pavlova. viridis) by using conventional DNA and RNA extraction and separation means in the art;
[0023] (2) The conservation region amplification process of the delta-5 desaturase gene is as follows:
[0024] (2.1) Using 5 μl of RNA as a template, the first strand of cDNA was synthesized by reverse transcription using polythymidine oligonucleotide primer (oligo dT Primer): 5'-oligod(T)15GTAAAACGACGGCCAGT-3';
[0025] (2.2) Using the above-mentioned first strand of cDNA as a template, and according to the conservatism of the delta-5 desaturase homologous gene, an upstream primer P3F and a downstream primer P3R are designed to ampl...
Embodiment 2
[0050] In order to verify the function of the above delta-5 desaturase gene, the first strand of cDNA was synthesized by reverse transcription using oligo dT Primer: 5'-oligod(T)15GTAAAACGACGGCCAGT-3' using the mentioned mRNA as a template, and used it as a clone delta- 5 Templates for expressing genes. Then, according to the obtained delta-5 full-length gene sequence, the upstream primer TAGGATTCATGGCTCCGCGCGACGCTTACACG and the downstream primer AAGCGGCCGCTTAGTGCTTGTGCTCGTGCACG were designed respectively, and amplified under the conditions of 94oC 3min; 94oC 30s, 60oC 30s, 72oC 1.5min, 30 cycles; 72oC 10min PCR conditions Express gene fragments. Subsequently, the fragment was connected to the vector pPIC3.5k by subcloning methods commonly used in the art to obtain the Pichia pastoris expression plasmid pPIC3.5k-delta-5, and then the plasmid and the empty vector were respectively electrotransformed into Pichia pastoris to obtain GS115 -5 and GS115-pPIC3.5K. Pick positive tra...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com