Primer, detection kit and preparation method for detecting porcine vesicular disease virus
A swine vesicular disease virus and detection kit technology, which is applied in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc., can solve problems such as insufficient sensitivity, difficulty in large-scale operation, and missed detection.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0018] The present invention is explained in detail below in conjunction with embodiment.
[0019] 1. Preparation of Sequences
[0020] According to the GeXP primer design requirements and the SVDV genome published by NCBI, select the conserved region to design specific primers, and form specific chimeric primers by adding universal primers, while the universal primer sequences belong to non-biological nucleotide sequences, and synthesized Universal primer sequence, and a Cy5 fluorescent tag is added to the 5' end of the upstream universal primer. The primer sequences capable of specifically amplifying porcine vesicular disease virus nucleic acid of the present invention are: AGGTGACACTATAGAATATTCAGAATGATTGCATATGGGG, named SVDV-F in the present invention; GTACGACTCACTATAGGGATCACGTTTGTCCAGGTTACC, named SVDV-R in the present invention. Universal primers used in the present invention: Cy5AGGTGACACTATAGAATA, named UWD-F in the present invention; GTACGACTCACTATAGGGA, named UEV-R i...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap