Check patentability & draft patents in minutes with Patsnap Eureka AI!

Zelkova SSR1 marker and primer pair and preparation methods and application thereof

A primer pair, zelkova technology, applied in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc., can solve problems such as poor stability

Inactive Publication Date: 2015-03-25
CENTRAL SOUTH UNIVERSITY OF FORESTRY AND TECHNOLOGY
View PDF4 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Although scholars at home and abroad have used ISSR, RAPD and other markers to study the genetic diversity of beech populations, both ISSR and RAPD markers are dominant markers with poor stability and cannot be directly applied to molecular marker-assisted breeding and QTL mapping

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Zelkova SSR1 marker and primer pair and preparation methods and application thereof
  • Zelkova SSR1 marker and primer pair and preparation methods and application thereof
  • Zelkova SSR1 marker and primer pair and preparation methods and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0029] Extraction and enzyme digestion of total DNA from beech

[0030] Select young beech leaves and extract the nuclear genome by CTAB method; use EcoRV to digest at 37°C for 3 hours, and inactivate the endonuclease at 65°C for 20 minutes; the reaction system is 20 μL, including 2.0 μL of 10×Buffer, 1.0 μL of EcoRV endonuclease, 2 μL of DNA, 15.0 μL of sterilized double distilled water;

[0031] Connection of connector

[0032] Connect the beech genomic DNA digested with EcoRV in step to the upper and lower linkers (upper linker sequence GTAATACGACTCACTATAGGGCACGCGTGGTCGACGGCCCGGGCTGGT, sequence listing SEQ.ID.No.4; lower linker sequence ACCAGCCC-NH2, sequence listing SEQ.ID.No.5); The 60 μL ligation system contains 9 μL enzyme-digested beech genomic DNA, 100 pmol each of the upper and lower adapters; the ligation reaction is carried out under the condition of 1 times T4 ligase buffer, and ligated overnight at 16°C; the ligated mixture is reacted at 65°C for 20 minutes to...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a Zelkova SSR1 marker and a primer pair and preparation methods and applications thereof. PCR amplification is carried out on Zelkova total DNAs of JS1 by an inventor utilizing a specific primer, so that the SSR1 marker with a simple and repeated sequence is obtained. The method is simple and practicable and simple and convenient to operate, the obtained simple and repeated sequence shows higher polymorphism for detection inside or among populations of three Zelkova natural colonies. The Zelkova SSR1 marker is a co-dominant marker; compared with other molecular markers, the SSR marker is good in repeatability and high in reliability, can be applied to Zelkova genetic diversity evaluation, Zelkova genetic map construction, Zelkova population heritable variation spatial distribution pattern and Zelkova origin and evolution research as well as target gene marking, and can also be applied to Zelkova molecular marker assistant breeding and QTL (quantitative Trait Locus) research.

Description

technical field [0001] The invention belongs to the technical field of molecular markers in biological sciences, in particular to a beech SSR1 marker, a pair of primers and a preparation method and application thereof. Background technique [0002] Zelkova schneideriana Hand.-Mazz. is a large deciduous tree belonging to the genus Zelkova in the family Ulmaceae, endemic to my country. Beech trees are distributed in the Huaihe River Basin in my country and the middle and lower reaches of the Yangtze River south of the Qinling Mountains. Beech wood is dense and hard, with bright color, beautiful texture and strong corrosion resistance. It is the first-class wood for the production of various high-end furniture and handicrafts. At the same time, because of its beautiful tree shape, large canopy, and rich seasonal changes in leaf color, it is also a popular traditional color-leaf garden landscape tree species. Due to the low germination rate of beech seeds, the difficulty of na...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C12Q1/68
Inventor 张日清汪灵丹金晓玲刘海龙
Owner CENTRAL SOUTH UNIVERSITY OF FORESTRY AND TECHNOLOGY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More