Recombination human CYP3A4 (cytochrome P450 3A4) /CPR (cytochrome P450 oxidoreductase) /cyt b5 (cytochrome b5) protein co-transfection co-expression method

A CYP3A4, co-transfection technology, applied in the field of biomedicine, can solve the problems of low activity, difficult hydrolysis, and difficult acquisition of expression vectors, and achieve the effect of high cell culture density, maintaining enzyme biological activity, and easy enzyme biological activity

Inactive Publication Date: 2015-04-29
EAST CHINA NORMAL UNIV
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Most of the proteins expressed in the E. coli expression system exist in the form of inclusion bodies, and the post-translational protein processing mechanism of E. coli is quite different from that of eukaryotic cells, which makes the activity of CYP3A4 low; in the yeast expression system, due to the presence of CPR in the yeast and the expressed protein will not form inclusion bodies and is not easy to be hydrolyzed, so it has certain advantages in the expression of CYP enzymes, and after the transformation of this system, the co-expression of human CPR and CYP3A4 has greatly improved the activity. However, the yeast system has codon preference when expressing CYP, and the yeast cells are difficult to break, and the expression vector is not easy to obtain; the Bac-to-Bac baculovirus expression system using insect Sf9 and Sf21 cells as host cells is a highly efficient true The nuclear expression system has been widely used in recent years. It has the characteristics of high expression level and complete post-translational protein modification mechanism. The activity of the protein complex obtained by co-expression of CYP3A4, CPR and cyt b5 has been improved, but blood red should be added during use In addition, because the infection of the recombinant baculovirus leads to the death and lysis of the host, freshly cultured cells must be re-infected for each round of foreign protein expression, so continuous culture cannot be carried out, resulting in The yield and activity of each expressed protein cannot be uniform

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombination human CYP3A4 (cytochrome P450 3A4) /CPR (cytochrome P450 oxidoreductase) /cyt b5 (cytochrome b5) protein co-transfection co-expression method
  • Recombination human CYP3A4 (cytochrome P450 3A4) /CPR (cytochrome P450 oxidoreductase) /cyt b5 (cytochrome b5) protein co-transfection co-expression method
  • Recombination human CYP3A4 (cytochrome P450 3A4) /CPR (cytochrome P450 oxidoreductase) /cyt b5 (cytochrome b5) protein co-transfection co-expression method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0079] Example 1 Amplification of CYP3A4, CPR and cyt b5 cDNA and Construction of Recombinant Plasmid

[0080] The sequences of CYP3A4, CPR, and cyt b5 cDNA fragments without removing the start codon and stop codon are SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3, respectively.

[0081] 1.1 Amplification of CYP3A4 cDNA

[0082] First design the following CYP3A4 cDNA primers, shown in SEQ ID NO.4 to SEQ ID NO.11, including the following:

[0083] F: CTAGTCTAGAACCATGGCTCTCATCCCAGACTTGGCCATGGAAACCTGGCT (SEQ ID NO. 4)

[0084] R: CCGCTCGAGGGCTCCACTTACGGTGCCATCCCTTGACTCAACCT (SEQ ID NO. 5)

[0085] P1: CTAGTCTAGAACCATGGCTCTCATCCCAGACTTGGC (SEQ ID NO. 6)

[0086] P2: AAATCTGAGGCGGGAAGCAGCTGCTTCCCGCCTCAGATTTCTCAC (SEQ ID NO. 7)

[0087] P3: CTGCTTCCCGCCTCAGATTTCTCACAAATCTGAGGCGGGAAGCAG (SEQ ID NO. 8)

[0088] P4: CCACCTATGATACTGTGCTATAGCACAGTATCATAGGTGG (SEQ ID NO. 9)

[0089] P5: TAGCACAGTATCATAGGTGGCCACCTATGATACTGTGCTA (SEQ ID NO. 10)

[0090] P6: CCGCTCGAGGGCTCCACTTACGGTGCCATC...

Embodiment 2

[0108] Example 2 The recombinant expression plasmid was transfected into Drosophila S2 cells and screened to obtain a stable monoclonal cell line.

[0109] Resuscitate Drosophila S2 cells with complete medium (Schneider’s Insect Medium plus 10% FBS) at 28°C without CO 2 cultured in an incubator for several days. When the cells are growing well, spread a 6-well plate, 3*10 per well 6 cells in a total volume of 3 ml and cultured for 1 day.

[0110] Calcium phosphate transfection method The recombinant expression vectors inserted into CYP3A4, CPR, and cyt b5 cDNA respectively and the selection plasmid pCoblast were co-transfected into S2 cells at a certain ratio, that is, the mass ratio was 6 μg: 6 μg: 6 μg: 1 μg. After culturing for 24 hours, replace with fresh complete medium and culture for 2 days. In other embodiments, the ratio of the recombinant expression vector CYP3A4:CPR:cyt b5 cDNA:selection plasmid can be any specific value within the range of 5-8:5-8:5-8:1.

[011...

Embodiment 3

[0114] Example 3 Preparation of monoclonal stably transfected cell microsomes co-expressing CYP3A4 / CPR / cyt b5

[0115] Large-scale culture of CYP3A4 / CPR / cyt b5 monoclonal stable cell line G3, and CuSO 4 (final concentration 750 μM) induced for 4 days.

[0116] The cells were collected by centrifugation at 3000rmp for 5min, and sucrose / Tris buffer (Tris 50mM; MgCl 2 3mM; sucrose 200mM, pH7.4), sonication, power 100W, ultrasonic 5s, interval 10s, 10 cycles. Centrifuge at 10,500 g for 25 min at 4°C after sonication. Transfer the supernatant to an ultracentrifuge tube, place in an ultracentrifuge, centrifuge at 105,000 g for 1 h at 4°C, and carefully discard the supernatant.

[0117] The precipitate was resuspended in 0.1M potassium phosphate buffer (pH 7.4) to obtain the CYP3A4 / CPR / cyt b5 microsomal solution, the protein concentration was determined by BCA method, and stored at -80°C for future use.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Half inhibitory concentrationaaaaaaaaaa
Login to View More

Abstract

The invention discloses a recombination human CYP3A4 (cytochrome P450 3A4) / CPR (cytochrome P450 oxidoreductase) / cyt b5 (cytochrome b5) protein co-transfection co-expression method. Expression vectors with CYP3A4, CPR and cyt b5 cDNA (complementary deoxyribonucleic acid) fragments and screening plasmids are co-transfected into drosophila S2 cells, the expression vectors are integrated into a drosophila cell genome, the cells are screened with blasticidin to obtain stable monoclonal cell strains, and the stably transfected monoclonal cell strains are subjected to enlargement culture for induction expression of three kinds of protein including CYP3A4, CPR and cyt b5. According to the method, the recombination vectors are easy to build, high in stability and capable of expressing three kinds of protein simultaneously, and have the advantages of high expression quantity, high activity and the like. The method can be widely used for researches of drug metabolism in vitro, drug screening development and application and the like.

Description

technical field [0001] The invention belongs to the technical field of biomedicine, and specifically relates to a method for co-transfection and co-expression of recombinant human CYP3A4 protein, CPR protein and cyt b5 protein. Background technique [0002] In the process of new drug development, the determination of drug metabolism pathways and the identification of major metabolites, as well as the effect of candidate drugs on drug metabolizing enzymes are important components of drug safety evaluation in the early stages of new drug development. In the early stage of new drug development, various in vitro models are used to study drug metabolism and drug-drug interaction in order to determine whether the candidate drug is worth continuing to develop. Recombinant human drug-metabolizing enzymes expressed by genetic engineering and cell engineering are an important model for in vitro metabolism research, and are mainly used to determine the subtypes of enzymes involved in d...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85C12N9/02C12N5/10C12N15/11C07K14/80
Inventor王昕刘明耀汤玉侯理理孙敏
OwnerEAST CHINA NORMAL UNIV