Breeding method using multispikelet germplasm NAU422 for improvement of wheat yield
A germplasm, wheat technology, applied in the direction of plant genetic improvement, botanical equipment and methods, biochemical equipment and methods, etc., can solve problems such as the narrow genetic foundation of wheat
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0021] (1) Design primers based on the EST sequence located in the second part of the common wheat homology group, and screen and identify the co-dominant molecular markers of the T2VS·2DL translocation chromosome
[0022] Using the EST sequence of wheat (http: / / wheat.pw.usda.gov / cgi-bin / westsql / map_locus.cgi) to design PCR primers, a co-dominant marker Xcinau2VS-1, (XCINAU2VS-1F: AGAAACTGGTGCTCAACCTA(SEQ ID NO.1), XCINAU2VS-1R:AACTTTTGCTTCTCATCTCG(SEQ ID NO.2)); T2VS·2DL translocation line NAU422 can amplify the specific band of 2VS 750bp, but lacks the specific band of wheat 2DS 900bp (Table 1, figure 2 ).
[0023] Table 1 Co-dominant molecular markers for the identification of T2VS·2DL translocation line NAU422 of common wheat-P.
[0024]
[0025] (2) Analysis of the agronomic characters of the T2VS·2DL translocation line NAU422 of common wheat-P.
[0026] In order to understand the effect of the translocation chromosome on the main agronomic traits and reveal the ut...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com