Construction method of recombinant bacillus subtilis capable of generating hyaluronic acid with specific molecular weight

A technology of Bacillus subtilis and hyaluronic acid, which is applied in the field of bioengineering, can solve problems such as poor product quality, high price, and risk of animal epidemic infection, and achieve the effects of reducing viscosity, easy purification and recovery, and great application advantages

Active Publication Date: 2015-11-25
JIANGNAN UNIV
View PDF2 Cites 36 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Hyaluronidase as a "diffusion factor" is widely used as a drug diffusion aid in clinical practice, but the current commercialized hyaluronidase is mainly prepared from bovine testicular tissue, and the product quality is poor, expensive and has the risk of animal foci infection. risk

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method of recombinant bacillus subtilis capable of generating hyaluronic acid with specific molecular weight
  • Construction method of recombinant bacillus subtilis capable of generating hyaluronic acid with specific molecular weight
  • Construction method of recombinant bacillus subtilis capable of generating hyaluronic acid with specific molecular weight

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] Example 1 Construction of integrated recombinant plasmid pAX01-hasA

[0056] The hyaluronic acid synthase hasA gene used in the present invention is derived from Streptococcus zoooepidemicus ATCC35246. The S. zooepidemicus strain was inoculated in 5 ml of M17 liquid medium and cultured at 37°C at 200 rpm for 16 hours. The bacteria were collected, and the genomic DNA of Streptococcus zooepidemicus strain was extracted using a bacterial genome extraction kit.

[0057] According to the published genome information sequence, the primers haveA-F / hasA-R were designed respectively, and the extracted genomic DNA was used as the template, and the standard PCR amplification system and procedures were used to amplify the hasA gene.

[0058] Primer sequence information: 5’-3’ direction

[0059] hasA-F: CGCGGATCCATGAGAACATTAAAAAACCTCATAAC

[0060] hasA-R: TGCATGCATTTATAATAATTTTTTACGTGTTCC

[0061] BamHI and SacII restriction enzyme sites were introduced at both ends of the upstream and downst...

Embodiment 2

[0062] Example 2 Construction of recombinant plasmid pP43NMK / pP43-DU-PBMS

[0063] Bacillus subtilis168 strain was inoculated into 5ml LB medium and cultured at 37°C and 200rpm for 16h. The bacterial cells were collected, and the genomic DNA of the Bacillus subtilis strain was extracted using a bacterial genome extraction kit. According to the published Bacillus subtilis168 genome information sequence, the primers tuaD-F / tuaD-R and glmU-F / glmU-R were designed respectively. The KpnI restriction site and P43RBS sequence (SEQ ID NO.14) were introduced at the 5 end of the upstream primer tuaD-F, and the SacI restriction site was introduced at the 5 end of the downstream primer tuaD-R; the upstream primer glmU-F SacI restriction enzyme site and P43RBS sequence were introduced at the 5 end of the primer, and XhoI and XbaI restriction enzyme sites were introduced at the 5 end of the downstream primer glmU-R. After the PCR amplification product was purified, the tuaD and glmU fragments...

Embodiment 3

[0078] Example 3 Construction of Integrated Fragment of Leech Hyaluronidase LHyal Gene

[0079] Using the bleomycin resistance gene Zeocin as the selection marker, the glucosamine-6-phosphate deaminase 1 (nagA-nagBA) gene site on the Bacillus subtilis genome was selected as the hyaluronidase integration site. Using integration plasmid homologous recombination technology to construct integration fragments (see attached figure 1 ). The primer information sequence of this embodiment is as follows:

[0080] H6LHyal-F: ATGCACAGTCTGCAGAATTCCACCACCACCACCACCACATG

[0081] H6LHyal-R: TTACTTTTTGCACGCTTCAACAT

[0082] ZHLHPlepA-F: CGCAGCCAAAGGAGTGGATTGCCTCAATCCTAGGAGAAACAG

[0083] ZHLHPlepA-R: GAATTCTGCAGACTGTGCATGAGC

[0084] ZHLH-front-F: TCAGCTGGTCTAGATCACTAGTC

[0085] ZHLH-front-R: AATCCACTCCTTTGGCTGCGCTC

[0086] ZHLH-zeocin-F: TTGAAGCGTGCAAAAAGTAAGAGCTCGGTACCCGGGGATCC

[0087] ZHLH-zeocin-R: GCTTGCATGCCTGCAGGTCGAC

[0088] ZHLH-back-F: CGACCTGCAGGCATGCAAGCCACTTCTTTCAGACGGAACCCTTGC

[0089] ZH...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a construction method of recombinant bacillus subtilis capable of generating hyaluronic acid with specific molecular weight, belonging to the field of the bioengineering technology. According to the method, the production of hyaluronic acid is realized through integration of hyaluronic synthase (hasA) with streptococcus zooepidemicus source to bacillus subtilis; meanwhile, overexpression is realized on key genes of the synthetic route of HA, so that the high yield of bacillus subtilis is realized; on the basis, the hyaluronidase with the leech source is integrated to the genome of the bacillus subtilis, then mutant library construction is realized on ribosome bind sites (RBS) from the genetic expression translational level, and thus a series of mutants with different expression levels of hyaluronidases are obtained through high throughput screening; the yield of the hyaluronic acid achieves 19.38g / L, the molecular weight ranges from 103-106 Dalton, certain basis is laid for efficiently preparing micromolecule hyaluronic acids, and the construction method is suitable for industrial production and application.

Description

Technical field [0001] The invention relates to a method for constructing a recombinant Bacillus subtilis producing hyaluronic acid with a specific molecular weight, and belongs to the technical field of bioengineering. Background technique [0002] Hyaluronic Acid (HA) is a high-viscosity polysaccharide isolated from the vitreous of bovine eye. It has good moisture retention, viscoelasticity, permeability and ductility, without any immunogenicity and toxicity. It is the best moisturizing substance found in nature and is widely used in cosmetics, food and medicine industries. In recent years, studies have found that low molecular weight HA (less than 1×10 4 Daltons) and hyaluronic acid oligosaccharides have unique biological functions. For example, small molecule oligosaccharides below 10,000 Daltons can promote wound healing and inhibit tumor cells. In addition, HA oligosaccharides are easily absorbed by the human body and used as precursors for the body's own HA and other poly...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/21C12N15/75C12P19/26C12R1/125
CPCC12P19/26C12N9/0006C12N9/1096C12N9/1241C12N9/2474C12N9/90C12Y101/01022C12Y206/01016C12Y207/07009C12Y207/07023C12Y302/01035C12Y504/0201
Inventor康振陈坚金鹏堵国成
OwnerJIANGNAN UNIV