Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Bacillus subtilis and application thereof in greenhouse soil remediation

A technology of Bacillus subtilis and greenhouses, applied in application, soil conditioning materials, bacteria, etc., can solve problems that have not been reported before, and achieve the effects of strong growth and reproduction, improved soil, improved and activated soil

Active Publication Date: 2015-12-16
新疆惠森生物技术有限公司
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although there are many reports on the study of the effects of organic materials on soil properties and crop yields in the field, the isolation and screening of strains that can improve greenhouse soil from greenhouse soil, and the use of self-selection to screen domesticated Bacillus subtilis There is no report on the preparation of soil remediation agent with other multi-strains according to the compatibility, applicability and safety of the strains and the characteristics of the strains to improve the soil of the greenhouse

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bacillus subtilis and application thereof in greenhouse soil remediation
  • Bacillus subtilis and application thereof in greenhouse soil remediation
  • Bacillus subtilis and application thereof in greenhouse soil remediation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1: Isolation, screening and identification of Bacillus Subtilis XHS0035KcCGMCCNO.9434

[0030] 1. Isolation and screening of strains

[0031] (1) Separation

[0032] The Bacillus subtilis used in the present invention is sampled and separated from the typical greenhouse soil with severe salinization, soil desertification or compaction in Korla, southern Xinjiang, and is initially screened out according to the analysis of the antagonism mechanism of the strains to the greenhouse soil. A strain with a certain antagonistic ability to soil problems such as salinization and soil compaction. Use the traditional plate culture method to isolate the microorganisms in the soil layer, purify the strains by the plate streak method, and use different culture temperatures, pH values, and medium as enrichment conditions to screen out a batch of well-growing microbial strains, and select one of them The strain whose serial number is XHS0035Kc.

[0033] Separation steps: acco...

Embodiment 2

[0040] Embodiment 2: the growth factor of Bacillus subtilis (Bacillus Subtilis) XHS0035KcCGMCCNO.9434

[0041] 1. Gram staining

[0042] Gram staining generally includes four steps: primary staining, mordant staining, decolorization, and counterstaining. The specific operation method is:

[0043] (1) Slides are fixed. Under sterile operating conditions, use an inoculation loop to pick a small amount of strain XHS0035Kc, spread it evenly on a clean glass slide, and heat it on a flame to kill the bacteria and make it adhere and fix.

[0044] (2) Ammonium oxalate crystal violet staining for 1 minute.

[0045] (3) Rinse with tap water to remove floating color.

[0046] (4) Mordant with iodine-potassium iodide solution for 1 minute, pour off excess solution.

[0047] (5) Decolorize with a neutral decolorizing agent such as ethanol (95%) or pyruvic acid for 30 seconds, the Gram-positive bacteria will not be faded but will be purple, and the Gram-negative bacteria will be colorle...

Embodiment 3

[0084] Example Three: Molecular Level of Bacillus Subtilis XHS0035KcCGMCCNO.9434

[0085] 1. PCR amplification of the 16SrDNA sequence of Bacillus subtilis and its sequencing

[0086] Pick a small amount of single colonies of the XHS0035Kc strain, put them into an EP tube filled with 25 μL of sterile water, boil at 100°C for 8-10 minutes, and then quickly put them into the ice-water mixture for 5 minutes. Centrifuge at 10000r / min for 5min, store at 4°C, and take the supernatant when used.

[0087] Determination of 16SrDNA gene sequence and construction of phylogenetic tree: Extract the total DNA of the strain according to conventional methods, dilute the universal primers with deionized water, and perform PCR amplification. The primers are designed as follows:

[0088] 27f:AGAGTTTGATCCTGGCTCAG

[0089] 1492r:TACGGCTACCTTGTTACGACTT

[0090] Determination of 16SrRNA gene sequence and construction of phylogenetic tree: extract the total DNA of bacterial strains according to co...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses bacillus subtilis and application thereof in greenhouse soil remediation. By carrying out strain isolating, screening, breeding and domesticating on a greenhouse soil sample as well as through 16S rDNA sequencing and phylogenetic analysis, 70-80 parts of bacillus subtilis XHS0035Kc CGMCC NO.9434, 20-40 parts of pseudomonas fluorescens, 25-45 parts of bacillus mucilaginosus and 15-35 parts of sporidiobolus pararoseus are mixed, and a mixed strain liquid is fully adsorbed in a carrier and is mixed with accessories, wherein the carrier is selected from greenhouse soil and the accessories include urine and calcium superphosphate; a greenhouse soil remediation compound is prepared by virtue of a fermentation technology; and the soil remediation compound has an outstanding technical effect in greenhouse soil remediation.

Description

technical field [0001] The invention relates to the technical field of application of agricultural microorganisms, in particular, the invention relates to a self-selected Bacillus subtilis and the technical field of its application in greenhouse soil restoration. Background technique [0002] In intensive agricultural production, soil is a spatio-temporal continuum, and the spatial variability of soil properties must be considered in precise management. At present, due to the lack of necessary fertilization guidance for farmers, many farmers mostly manage fertilization based on their own experience, and believe that "high input, high output", which leads to a large number of blind excessive fertilization often occurs. However, although excessive fertilization can increase crop yields in the short term, in the long run, excessive fertilization will lead to a decrease in soil productivity, crop yield reduction, and the risk of groundwater pollution. [0003] After several yea...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/20C09K17/00C12R1/125C12R1/39C09K101/00
Inventor 王心歌张松林韩友青
Owner 新疆惠森生物技术有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com