A method for rationally designed enzymes to regenerate ATP

A rational polyphosphokinase technology, applied in biochemical equipment and methods, enzymes, transferases, etc., can solve the problems of high price, cumbersome production process, and inability to couple enzymes at room temperature

Active Publication Date: 2021-05-04
BEIJING UNIV OF CHEM TECH
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

For example, the polyphosphate kinase TePpk derived from Thermotoga maritima is a thermophilic enzyme. Its optimum temperature is 70 degrees, and it is suitable for participating in reactions with higher temperatures. The lower enzyme activity is low, and it cannot be coupled with room temperature enzymes, so it cannot widely meet the needs of industrial production
There are also some polyphosphate kinases. Although the optimum temperature is about 30 degrees, the polyphosphate used has a high degree of polymerization. This polyphosphate with a high degree of polymerization is not easy to obtain in the market and is expensive. Increased production difficulty and production cost
On the other hand, with regard to industrial mass production of ATP, some polyphosphate kinases can be inhibited by polyphosphate, so the method of feeding polyphosphate has to be adopted in large-scale production to reduce inhibition and make the production process easier. cumbersome

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for rationally designed enzymes to regenerate ATP
  • A method for rationally designed enzymes to regenerate ATP
  • A method for rationally designed enzymes to regenerate ATP

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Mutation and cloning of rationally designed polyphosphate kinase gene from Sinorhizobium meliloti

[0027] The polyphosphokinase gene ppk from Sinorhizobium meliloti was mutated into ppk(ket) by site-directed mutagenesis. Using the strain's original gene recombination vector as a template, design primers according to the GenBank sequence, and operate according to the instructions of the TaKaRaMutanBEST kit.

[0028] The primers used for site-directed mutagenesis are as follows:

[0029] F1:GCGATCAAAGCGACGACGGAAAATATGAACCCCCGCTC

[0030] R1: ACCACCCTTGCCGGCAGCGT

[0031] F2: GCGCGCACCGTCGCACTGACGAAACCGA

[0032] R2: GGAGCGGGGGTTCATATT

[0033] The size of the mutated recombinant vector fragment is about 6000bp, see the nucleic acid electrophoresis figure 1 .

Embodiment 2

[0035] Transform the constructed expression vector, pET22b-ppk (ket) plasmid, into BL21 (DE3) Escherichia coli, use LB medium after picking the bacteria, and grow at 37°C until the OD600 is about 0.4-1.0, then add 0.1mM-1mM Induced by IPTG, intracellular expression was performed at 30°C. The vector pET22b was transformed into BL21(DE3) Escherichia coli, and the expression was induced under the same conditions as above, and the expressed crude enzyme solution was subjected to protein electrophoresis to verify the expression results. The protein electrophoresis was as follows: figure 2 As shown, the protein content measured by Coomassie brilliant blue method was 8.4g / L.

Embodiment 3

[0037] The kinetic parameters of PPK enzyme were measured when tetrapolyphosphate was used as substrate. Six groups of experimental systems 1 numbered 1, 2, 3, 4, 5, and 6 were set up, and the concentrations of tetrapolyphosphate in the system were 2mM, 4mM, 8mM, 10mM, 15mM, and 20mM, respectively. Add ADP corresponding to twice the concentration of hexametaphosphate, 30mM MgCl 2 , PPK crude enzyme solution 200ul (containing protein 0.12mg), adding different amounts of 3M Tris-HCl pH 8.0 to adjust the pH of the system to 8.0, system 1 was reacted at 37 degrees for 5 minutes and then placed in a 60 degrees water bath for 20 minutes to inactivate the PPK enzyme. Take the corresponding supernatant and add it to NADPH reaction system 2, marked as 1, 2, 3, 4, 5, 6. The corresponding glucose concentration of each group in system 2 is 1mM, 2mM, 3mM, 4mM, 5mM, 7mM glucose and NADP, and the amount of hexokinase and glucose-6-phosphate dehydrogenase in the corresponding numbered experi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to a method of rationally designed enzymes for the regeneration of ATP. Through rational design after sequence comparison, polyphosphate kinase derived from Sinorhizobium meliloti was mutated and heterologously expressed, and under its catalysis, polyphosphate with a low degree of polymerization was used as a phosphate donor to regenerate ATP. Compared with the existing ATP regeneration method, the polyphosphate kinase used in the present invention is an enzyme at room temperature, which can be coupled with various enzymatic reactions. Compared with polyphosphoric acid, tetrapolyphosphoric acid is more common and easy to obtain, which increases the feasibility of ATP regeneration and reduces the cost of ATP regeneration on the basis of simplifying the ATP regeneration process. The activity of PPK enzyme is not inhibited by the concentration of polyphosphate, which provides the possibility for industrial large-scale production.

Description

technical field [0001] The invention belongs to the field of biochemical industry, in particular to a method for regenerating ATP with a rationally designed enzyme. Background technique [0002] ATP is the most important high-energy phosphate compound in the body, and it is widely used in medicine as a treatment or an important auxiliary treatment drug for muscle atrophy, myocardial infarction, hepatitis and various emergency diseases. There are also many biosynthetic processes of important bioactive substances or biochemical drugs in industry, which are also enzymatic reactions that require ATP to participate. Therefore, the production of ATP and the recycling of ATP in industry have become an important issue in the development of enzyme engineering, and are the key factors to determine whether industrial production is economical. [0003] In recent years, the research on ATP regeneration is mainly based on the method catalyzed by polyphosphate kinase, that is, ADP and pol...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12P19/32
CPCC12N9/1229C12P19/32C12Y207/04001
Inventor刘珞李成成曹浩
OwnerBEIJING UNIV OF CHEM TECH