Tool for efficient site-specific transposition of genes and application of tool

A transgenic and efficient technology, applied in the field of genetic engineering, can solve problems such as safety and hidden dangers, and achieve the effect of efficient targeted transgenic

Active Publication Date: 2016-06-08
WUXI MATERNAL & CHILD HEALTH HOSPITAL
View PDF4 Cites 47 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Using the Piggbac transposon system can achieve high-efficiency transgenesis in animal cells, but the integration of foreign genes is still random, so there are potential safety hazards in practical applications

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tool for efficient site-specific transposition of genes and application of tool
  • Tool for efficient site-specific transposition of genes and application of tool
  • Tool for efficient site-specific transposition of genes and application of tool

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1 High-efficiency site-directed transgene vector for human ROSA26 locus

[0038] In this example, the high-efficiency site-directed transgene vector targeting human ROSA26 locus is taken as an example to illustrate the method for constructing the transgene tool (vector) of the present invention.

[0039] 1. Kpn1 and Fse1 double digested the PX260-U6-DR-BB-DR-Cbh-NLS-hSpCas9-NLS-H1-shorttracr-PGK-puro (D-A) vector (purchased from Addgene), and the gel recovered fragments larger than 5bk. Gene synthesis aaaGGTACCCTGCAGCTAGCCTGCTGcaattgactatGTCGACactatggccggcccct fragment, Kpn1 and Fse1 double digestion, inserted into the recovered backbone vector to obtain vector 1 (Vector1).

[0040] 2. Use agaggtaccgcgttacataacttacggtaa and AGGCTAGcggatctgacggttcactaaaccagctct as upstream and downstream primers, use pEGFP-N1 (purchased from Shanghai Jiman Biology) as a template to amplify CMVpromoter, insert Kpn1 and Nhe double restriction enzymes into Vector1, select clone and ...

Embodiment 2 Embodiment 1

[0044] Example 2 Application of Example 1 Vector in High Efficiency Site-Specific Transgenesis

[0045] In this example, the EGFP-marked neomycin resistance gene is used as the exogenous target gene to illustrate the method of using the vector described in Example 1 to transfer the exogenous target gene efficiently and site-specifically.

[0046] 1. Online (http: / / crispr.mit.edu / ) design specific gRNA targeting human ROSA26 locus, first synthesize aaacGAGGCTGTGCTTCGGCGCTC and taaaGAGCGCCGAAGCACAGCCTC oligoDNA, mix 1:1 after dissolving in double distilled water, incubate at 94°C for 30s, 72 Incubate at ℃ for 2 minutes, insert and store on ice, take 0.5 μl of the mixture and add it to the Bsa1 enzyme-cut site-directed transposase expression plasmid, react with T4 ligase at 16℃ for 2 hours, heat shock at 42℃ to transform competent cells, and apply to ampicillin The LB solid medium culture plate was cultured overnight, the bacteria were picked and inoculated into the liquid LB med...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of gene engineering and particularly discloses a tool for efficient site-specific transposition of genes. The tool comprises or can produce a gRNA-Cas9 protein (without incision enzyme activity)-PB transposase compound, and gRNA targets the specific site of a genome; the Cas9 protein without incision enzyme activity is double-mutant Cas9 protein with 10th-site amino acid residue D mutating into A and 840th-site amino acid residue H mutating into A. Through design of gRNA (guide RNA) targeting the animal genome, under the coexpression condition of gRNA and site-specific transposase, PB transposase is targeted to a specific position of the genome along with a CRISPR / cas9 and gRNA compound, the PB transposase realizes a transposition function at the specific site, accordingly, donor plasmids (carriers containing exogenous target genes) are simultaneously co-transfected, the exogenous target carriers can be transposed to the specific site in the genome through transposition, and site-specific transposition of the genes is realized.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a tool for high-efficiency fixed-point transgene. Background technique [0002] Site-directed transgenesis is the precise integration of the target gene into the predetermined position of the genome, which can effectively avoid the random integration of foreign genes, causing insertion mutations of host genes and resulting in unpredictable effects. In addition, the integration of exogenous genes into the inactive regions of the genome is affected by the position effect, resulting in low expression or complete silence of exogenous genes. Through genomics research and bioinformatics analysis, it is found that there are some safe sites for gene expression in the animal genome. When the foreign gene is integrated into this site in the genome, the foreign gene will neither affect the stability and safety of the animal's own genome , the expression of exogenous genes will not be aff...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N9/22C12N15/85
CPCC07K14/00C07K2319/00C12N9/22C12N15/85C12N2999/007
Inventor方锐赵馨陈道贞蔡立義肖建平
OwnerWUXI MATERNAL & CHILD HEALTH HOSPITAL