A kind of ischemic stroke screening kit and its application
A technique for ischemic stroke and cerebral apoplexy, which is applied in the direction of biochemical equipment and methods, microbial measurement/testing, etc., and can solve the problems of limited wide application of cerebral hemorrhage in the treatment time window
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Example 1: To predict the target site of miRNA-98 acting on PAFR, the interaction between miRNA-98 and the promoter region of PAFR was detected by using a dual luciferase reporter gene.
[0039] (1) pairing indication Figure 12 shown;
[0040] (2) Design primers
[0041] PTAFR-miR98-5p F (SEQ ID NO: 1): XhoI: cacaactcgag TCATTTCCTGTGTACCGGGC;
[0042] PTAFR-miR98-5pR (SEQ ID NO: 2): BamHI: aaggatcc TAAGGGACCTGCAAAAGCCTG;
[0043] PTAFR-miR98-5pM R (SEQ ID NO: 3): CTCCATCCTTTAACCTCATAGGTAATGACCCTAACTCCATCGAAATTCAGTGCCTGGT;
[0044] PTAFR-miR98-5pM F (SEQ ID NO: 4): GATGGAGTTAGGGTCATTACCTATGAGGTTAAAGGATGGAGATGGGATTGTTATACGCC;
[0045] The size of the PCR product is 442bp.
[0046] (3) Construction of pLUC-PTAFR reporter gene vector:
[0047] The contained 3'UTR sequence is as follows (SEQ ID NO:5):
[0048]
[0049] (4) Construction of pLUC-PTAFRMut reporter gene vector:
[0050] The contained 3'UTR sequence is as follows (SEQ ID NO:6):
[0051]
[005...
Embodiment 2
[0060] Example 2: Detection of the expression of miRNA-98 in the serum of stroke patients, the serum of ischemic stroke model animals, and the penumbra
[0061] Detection method: Real-time PCR
[0062] Test result: if figure 2 A ~ C shown.
[0063] Result analysis: Compared with the healthy control group, the miRNA-98 in the serum of stroke patients was significantly lower; compared with the animals of the sham operation group, the expression of miRNA-98 in the serum and penumbra of the ischemic stroke animals was significantly lower.
Embodiment 4
[0064] Example 4: Detection of platelet activating factor level in serum of stroke patients.
[0065] Detection method: ELISA assay kit was used to detect the content of PAF in serum of patients.
[0066] Result determination: if image 3 shown.
[0067] Analysis of the results: Compared with the healthy control group, the serum PAF of stroke patients increased 3.4 times, up to 505.7±93.6pg / ml.
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com