Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Bacillus atrophicus strain bsr05 and its application

A technology of Bacillus atrophicus and strains, applied in the field of Bacillus atrophicus BsR05 strains, can solve the problems of difficult to guarantee shelf life, difficult preservation of live bacteria preparations, etc., and achieve the effect of improving effect, stabilizing effect, and promoting plant growth.

Active Publication Date: 2020-02-18
BIOTECH CENT OF SHANDONG ACAD OF SCI
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Most of the existing beneficial microorganisms for the prevention and treatment of gray mold are direct use of bacterial strains or bacterial agents to prevent and control diseases, such as Trichoderma, etc. However, because live bacterial preparations are not easy to preserve, their shelf life is difficult to guarantee

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bacillus atrophicus strain bsr05 and its application
  • Bacillus atrophicus strain bsr05 and its application
  • Bacillus atrophicus strain bsr05 and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Identification of Bacillus atrophaeus

[0022] BsR05 was identified as Bacillus atrophaeus by 16S rDNA sequence alignment combined with the determination of physiological and biochemical characteristics. Specific steps are as follows:

[0023] (1) 16SrDNA sequence analysis

[0024] Genomic DNA of BsR05 cells was extracted, PCR amplified with bacterial 16SrDNA universal primers (16s F: 5'AGAGTTTGATCCTGGCTCAG3'; 16s R: 5'TACGGCTACCTTGTTACGACT 3'), and then recovered with an agarose gel recovery kit. The recovered and purified PCR product was sent to Shanghai Sangon Biotechnology Company for sequencing to obtain SEQ ID NO1:

[0025] CTGGAATCGC TAGTAATCGC GGATCAGCAT GCCGCGGTGA ATACGTTCCC GGGCCTTGTA 60

[0026] CACACCGCCC GTCACACCAC GAGAGTTTGT AACACCCGAA GTCGGTGGGG TAACCTTTTT 120

[0027] GGAGCCAGCC GCCTAAGGTG GGACAGATGA TTGGGGTGAA GTCGTAACAA GGTAGCCGTA 180

[0028] TCGGAAGGTG CGGCTGGATC ACTATTGGAG AGTTTGATCC TGGCTCAGGA TGAACGCTGG 240

[0029] CGGCGTGCCT AATACATGCA AGT...

Embodiment 2

[0055] Embodiment 2: the preparation of bacillus atrophaeus (Bacillus atrophaeus) BsR05 inoculum, the steps are as follows:

[0056] (1) Slant strains: use solid LB medium, inoculate Bacillus atrophaeus (Bacillus atrophaeus) BsR05 test tube strains in the test tube culture medium, and cultivate them at a constant temperature of 30°C for 24 hours to obtain slant strains.

[0057] (2) Shake flask strains: using liquid LB medium, inoculate a single colony of slant strains in the liquid LB medium and place it on a shaker at a constant temperature of 30°C for 18 hours to obtain a seed solution.

[0058] (3) Liquid fermentation: The culture medium is: 2% corn flour, 6% soybean meal, 0.2% (NH 4 ) 2 SO 4 , 0.2%KH 2 PO 4 2H 2 O, 0.4%K 2 HPO 4 2H 2 O, 0.05%FeSO 4 ·5H 2 O, 0.3%CaCO 3 , pH 7.0-7.5, sterilized at 121°C for 20 minutes, inoculated the seed liquid from step (2) into a 10-liter fermenter (2% inoculum), cultivated at 30°C, and the ratio of air flow per minute to the ...

Embodiment 3

[0060] Embodiment 3: the antagonism of bacillus atrophaeus (Bacillus atrophaeus) BsR05 to cucumber botrytis

[0061] Pathogens for testing: Botrytis cinerea Pers.ex Fr. is preserved by the Institute of Biology, Shandong Academy of Sciences. Using the confrontation culture method, Botrytis cinerea Pers.ex Fr. is first activated on the PDA plate, and after 5 days of cultivation, it is sprayed on the edge of the colony. Make a 5mm pathogenic bacteria cake by punching with a hole punch, transfer the pathogenic bacteria cake to the center of the PDA plate, inoculate Bacillus atrophaeus BsR05 at a distance of 2.0cm from the bacterial cake, and use the plate only inoculated with the pathogenic bacteria cake as a control. The treatment was repeated 3 times. Cultivate in an incubator at 25°C. When the blank control covers the entire petri dish, measure the control colony radius and the inhibition growth radius after inoculation with BsR05, and use the antagonistic inhibition rate (inhi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses the Bacillus atrophaeus BsR05 strain and application thereof. The Bacillus atrophaeus BsR05 strain is preserved in the General Microbiology Center of the China Committee for the Collection of Microorganisms, and the preservation number is CGMCCNO.11665. The liquid suspension of Bacillus atrophaeus BsR05 prepared by the bacterial strain of the invention has specific control effect on cucumber gray mold, and the control effect is high and the average control effect is more than 70%.

Description

technical field [0001] The invention relates to the technical field of agricultural microorganism control, in particular to the bacillus atrophaeus BsR05 strain and application thereof. Background technique [0002] Cucumber gray mold is a worldwide epidemic disease caused by the infection of the fungus Botrytis cinerea Pers.ex Fr., and it is a disease that occurs all year round in the cultivation of cucumbers in protected areas. It has occurred in recent years. It is getting heavier year by year. Because the fruit is often infested and causes rot, vegetable farmers often call it rotten fruit disease and mildew rot disease. At present, the gray mold disease of cucumber is becoming more and more serious, resulting in a large number of rotten melons. Greenhouses with severe disease can generally reduce production by 20-30%, and even pull seedlings in advance, seriously affecting the yield and quality of cucumbers. One of the important factors causing the occurrence of gray m...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/20A01N63/22A01P3/00C12R1/07
CPCA01N63/00C12N1/20C12N1/205C12R2001/07
Inventor 扈进冬李纪顺杨合同陈凯魏艳丽王贻莲
Owner BIOTECH CENT OF SHANDONG ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com