Rice gene osein2l and its application

A gene and rice technology, applied in the fields of application, genetic engineering, plant gene improvement, etc., can solve the problem of no separation and cloning, and achieve the effect of promoting elongation

Active Publication Date: 2019-09-10
HUAZHONG AGRI UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, many scholars have located the genetic loci that affect the elongation of the rice mesocotyl, but have not isolated and cloned a gene that controls the rice mesocotyl

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rice gene osein2l and its application
  • Rice gene osein2l and its application
  • Rice gene osein2l and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Cloning of the gene OsEIN2L:

[0039]Pick the BAC (OSJNBb0024B16) of the rice variety Nipponbare (Nip), use LB medium containing 1‰ chloramphenicol to amplify, extract the BAC plasmid, use the BAC plasmid as a template, and use primers (the primer sequences are CATGATTACGAATTCGAGCTACGGATAAAGTATTTGATACTCCC and AACTCATGAAGGAACTATGGTGCAGAATTCACTCAAAAC) and primers (the primer sequence is GGATCCCCGGGTACCGAGCTAGTGGAGATTTCAGAAAGCC and CCATAGTTCCTTCATGAGTTCCTCTGAATGCCTTCTGCAGATGTTC synthesized by Wuhan Qingke) for polymerase chain reaction (PCR), PCR program: 94 ° C: 2min, 28 cycles (94 ° C: 15s, 68 ° C: 4min), will get The two PCR products were mixed 1 to 1 as templates, and then a new round of PCR was carried out with primers (primer sequences: CATGATTACGAATTCGAGCTACGGATAAAGTATTTGATACTCCC and GGATCCCCGGGTACCGAGCTAGTGGAGATTTCAGAAAGCC). The program was: 94°C: 2min, 25 cycles (94°C: 15s, 68°C: 5min30s ), the amplified product was sequenced to obtain the nucleotide sequence of t...

Embodiment 2

[0041] Construction of recombinant vector and establishment of transformed Agrobacterium:

[0042] according to figure 1 The technical route is to extract the DNA of the rice variety Nipponbare, and use the primer sequences (AAAGAGCTCGGATCCCCAGCGAGCTTTCTTTTGTTTCT and AAAACTAGTGGTACCCCTTTACAATGTTGCTGCTCCAG) to carry out polymerase chain reaction (PCR) to obtain a 259bp nucleotide fragment of OsEIN2L, the sequence is shown in SEQ ID No.4. PCR program: pre-denaturation at 94°C for 5 minutes; 35 cycles (denaturation at 94°C for 30 seconds; annealing at 62°C for 30 seconds; extension at 72°C for 30 seconds), and extension at 72°C for 7 minutes. The target fragment was first digested with BamHI and KpnI, and the target product was separated and recovered, and then ligated with the pDS1301 vector (Chu ZH et al., 2006) digested with BamHI and KpnI to form intermediate vector 1 with T4 ligase, and then the target fragment was Digested with SacI and SpeI, separated and recovered, ligat...

Embodiment 3

[0045] Agrobacterium-mediated genetic transformation:

[0046] (1), induction:

[0047] The seeds of mature rice varieties (Nihonbare, a japonica rice variety disclosed in China) were shelled, then treated with 70% ethanol by volume for 1 minute, and 0.15% concentration of mercuric chloride (HgCl 2 ) Disinfect the surface of the seeds for 15 minutes; wash the seeds 4-5 times with sterilized water; place the seeds on the japonica rice induction medium; place the inoculated medium in a dark place for 4 weeks at a temperature of 25±1°C.

[0048] (2), Succession:

[0049] Select bright yellow, compact and relatively dry embryogenic calli, and place them on the japonica rice subculture medium for 2-3 weeks in the dark at a temperature of 25±1°C.

[0050] (3), pre-cultivation:

[0051] Select compact and relatively dry embryogenic calli, put them on the japonica rice pre-medium and culture them in the dark for 4-5 days at a temperature of 25±1°C.

[0052] (4), Agrobacterium cult...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a rice gene OsEIN2L and an application thereof. The sequence of the rice gene OsEIN2L is as shown in SEQ ID NO.1, the corresponding cDNA sequence is as shown in SEQ ID NO.2, and the encoded protein is as shown in SEQ ID NO.3. By inhibiting expression of OsEIN2L in rice, a rice strain with mesocotyl elongation can be obtained. The applicant also designs a molecular maker primer for the gene: CGTATATGCCCTCGTCTCGACT and AAAGCTCGTGCTATGCCCGTGC. By adopting the marker, allele with mesocotyl elongation can be rapidly identified, and cultivation of novel rice strains with mesocotyl elongation can be assisted.

Description

technical field [0001] The invention belongs to the technical field of plant genetic engineering. It specifically relates to a rice gene OsEIN2L, and also relates to a preparation method of the rice gene OsEIN2L, and also relates to the use of the gene OsEIN2L. Background technique [0002] Rice is the main food crop in my country and the whole world. About 2.2 billion people in the world depend on rice, and 60% of China's population depends on rice. Rice direct seeding, as a time-saving, labor-saving, labor-saving and efficient cultivation technique, is receiving increasing attention. However, due to problems such as difficulty in seedling emergence and inconsistent emergence of direct-seeding rice, the development of direct-directed rice is restricted (Zhu Defeng, 1997). The elongation of mesocotyls provides the main source of power for seedling emergence, but most rice varieties are difficult to adapt to seedling emergence due to the short elongation of mesocotyls. The...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/11C12Q1/68A01H5/00A01H6/46
Inventor 余四斌熊银肖雄峰袁志阳张超普
Owner HUAZHONG AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap