Unlock instant, AI-driven research and patent intelligence for your innovation.

Rice RH4 gene and application thereof

A rice and gene technology, applied in the direction of genetic engineering, plant genetic improvement, application, etc., can solve the problems of being unsuitable for mixed sowing and seed production, and achieve the effects of easy cloning and genetic engineering operations, short coding sequences, and easy access

Active Publication Date: 2019-02-15
HUNAN AGRICULTURAL UNIV +1
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The black glume mutant bh4 is caused by the mutation of Os04g0460000, but it is a dominant inheritance and is not suitable for mixed seed production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rice RH4 gene and application thereof
  • Rice RH4 gene and application thereof
  • Rice RH4 gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Cloning of gene RH4:

[0031] Download the LOC_Os12g10880 genome nucleotide sequence from http: / / rice.plantbiology.msu.edu / analyses_search_locus.shtml, design primers 80FP (AACTTAATTAAGCAAGCAGACGACG), 80RP (GCCAAGAGGATGCCACTTTTCAA) (synthesized by Wuhan Qingke), and first recover 207 genome DNA As a template, carry out polymerase chain reaction (PCR), PCR program: 98°C, 3min; 30 cycles (98°C, 10s; 55°C, 15s; 68°C, 40s); 68°C, 5min. The product was sequenced to obtain the genome nucleotide sequence of the gene RH4. It consists of 469 nucleotides, and the nucleotide sequence shown is shown in SEQ ID No.1. The glume RNA of heading 10 days was extracted, reverse-transcribed into cDNA, polymerase chain reaction was carried out with primers CDS-80-F1 (ATGGTGGCGCTCATCAGG), CDS-80-R1 (TCATGGACGACCACCTCCG), and the coding sequence of RH4 (CDS ), PCR program: 98°C, 3min; 30 cycles (98°C, 10s; 55°C, 15s; 68°C, 30s); 68°C, 5min. The product was sequenced to obtain the coding nuc...

Embodiment 2

[0033] Construction of recombinant vector and establishment of transformed Agrobacterium:

[0034] according to figure 1 The technical route is to extract the glume RNA of heading 10 days, reverse transcribe it into cDNA, and use primers CDS-80-PstI-F1 (AACTGCAGAACCAATGCATTG GATGGTGGCGCTCATCAGG), CDS-80-BamHI-R1 (CGGGATCCCGTCATGGACGA CCACCTCCG) to carry out polymerase chain reaction, The coding sequence (CDS) of RH4 was obtained by sequencing the PCR product. PCR program: 98°C, 3min; 30 cycles (98°C, 10s; 55°C, 15s; 68°C, 30s); 68°C, 5min. The product was sequenced to obtain the coding nucleotide sequence of the gene RH4, which is shown in SEQ ID No.4. The target fragment was first digested with PstI and BamHI, and the target product was separated and recovered ( figure 2 ), and pSB130-Ubi digested with PstI and BamHI were ligated with T4 ligase to form an overexpression vector. The above primers were synthesized by Shanghai Sangong, and the restriction enzymes (BamHI and ...

Embodiment 3

[0037] Agrobacterium-mediated genetic transformation: This process was completed by Wuhan Boyuan Biotechnology, and the transformed rice line was G4 (rh4 mutant).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a rice RH4 gene which is named as RED HULL 4(RH4), has a nucleotide sequence shown by SEQ ID No.1 as shown in the specification, and has an encoded protein shown by SEQ ID No.2as shown in the specification. The gene is inserted into a eukaryotic vector, then RH4 gene overexpressed eukaryon recombinant plasmid is obtained, the eukaryon recombinant plasmid is transferred into an rh4 red glume mutant, an RH4 gene overexpressed transgenetic seedling is obtained, and the phenotype of the seedling is recovered as cereal yellow. The gene joins in biological synthesis of flavonoid, is capable of regulating and conditioning the glume color of rice and can be applied to mechanical seed breeding.

Description

technical field [0001] The invention relates to the field of plant genetic engineering, in particular to a rice gene involved in flavonoids and the application of the gene in glume color and mixed seed production. Background technique [0002] Rice is the main food crop in the world and one of the most important food crops in my country. More than 50% of the world and more than 65% of the population in my country take rice as a staple food. The promotion and application of hybrid rice has become a booster for world food growth, so the realization of the full mechanization of hybrid rice seed production will also become the most important project in the rice industry in the 21st century. The successful application of hybrid rice is the result of the close combination and high matching of breeding technology, seed production technology and planting promotion technology, which has played an important role in ensuring my country's food security. Hybrid rice seed production is ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C07K14/415C12N15/82A01H5/00A01H6/46C12N15/11
CPCC07K14/415C12N15/8261
Inventor 段美娟许可谭炎宁刘玲袁定阳袁光杰余东孙志忠孙学武盛夏冰欧阳宁
Owner HUNAN AGRICULTURAL UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More