Rice RH4 gene and application thereof
A rice and gene technology, applied in the direction of genetic engineering, plant genetic improvement, application, etc., can solve the problems of being unsuitable for mixed sowing and seed production, and achieve the effects of easy cloning and genetic engineering operations, short coding sequences, and easy access
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Cloning of gene RH4:
[0031] Download the LOC_Os12g10880 genome nucleotide sequence from http: / / rice.plantbiology.msu.edu / analyses_search_locus.shtml, design primers 80FP (AACTTAATTAAGCAAGCAGACGACG), 80RP (GCCAAGAGGATGCCACTTTTCAA) (synthesized by Wuhan Qingke), and first recover 207 genome DNA As a template, carry out polymerase chain reaction (PCR), PCR program: 98°C, 3min; 30 cycles (98°C, 10s; 55°C, 15s; 68°C, 40s); 68°C, 5min. The product was sequenced to obtain the genome nucleotide sequence of the gene RH4. It consists of 469 nucleotides, and the nucleotide sequence shown is shown in SEQ ID No.1. The glume RNA of heading 10 days was extracted, reverse-transcribed into cDNA, polymerase chain reaction was carried out with primers CDS-80-F1 (ATGGTGGCGCTCATCAGG), CDS-80-R1 (TCATGGACGACCACCTCCG), and the coding sequence of RH4 (CDS ), PCR program: 98°C, 3min; 30 cycles (98°C, 10s; 55°C, 15s; 68°C, 30s); 68°C, 5min. The product was sequenced to obtain the coding nuc...
Embodiment 2
[0033] Construction of recombinant vector and establishment of transformed Agrobacterium:
[0034] according to figure 1 The technical route is to extract the glume RNA of heading 10 days, reverse transcribe it into cDNA, and use primers CDS-80-PstI-F1 (AACTGCAGAACCAATGCATTG GATGGTGGCGCTCATCAGG), CDS-80-BamHI-R1 (CGGGATCCCGTCATGGACGA CCACCTCCG) to carry out polymerase chain reaction, The coding sequence (CDS) of RH4 was obtained by sequencing the PCR product. PCR program: 98°C, 3min; 30 cycles (98°C, 10s; 55°C, 15s; 68°C, 30s); 68°C, 5min. The product was sequenced to obtain the coding nucleotide sequence of the gene RH4, which is shown in SEQ ID No.4. The target fragment was first digested with PstI and BamHI, and the target product was separated and recovered ( figure 2 ), and pSB130-Ubi digested with PstI and BamHI were ligated with T4 ligase to form an overexpression vector. The above primers were synthesized by Shanghai Sangong, and the restriction enzymes (BamHI and ...
Embodiment 3
[0037] Agrobacterium-mediated genetic transformation: This process was completed by Wuhan Boyuan Biotechnology, and the transformed rice line was G4 (rh4 mutant).
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com