GFP-CD19 fusion protein and application thereof in cell marking aspect
A GFP-CD19, fusion protein technology, applied in the direction of fusion with spectral/fluorescence detection, hybrid peptide, recombinant DNA technology, etc., can solve problems such as increased risk, cytotoxicity, and increased immunogenicity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0057] GFP-CD19 fusion protein (green fluorescent protein), including 776 amino acids, molecular weight 85KD, its amino acid sequence is shown in SEQ ID NO.1. Since the acquisition of the protein is a key part of the implementation of the present invention, the preparation process of the protein is briefly introduced in this example as follows.
[0058] 1. Design primers, carry out PCR amplification, and obtain the gene sequence of CD19 molecule and the gene sequence of GFP molecule respectively;
[0059] The primer sequences used during PCR amplification of the gene sequence of the CD19 molecule are as follows:
[0060] Upstream primer: 5'- AGGATCCgaggaacctctagtggtgaagg-3',
[0061] Downstream primer: 5'-CAAGCTTtcacctggtgctccaggtgccc-3';
[0062] The primer sequences used during the PCR amplification of the gene sequence of the GFP molecule are as follows:
[0063] Upstream primer: 5'- GCATATGGTGAGCAAGGGCGAGGAG -3',
[0064] Downstream primer: 5'- AGGATCCCTTGTACAGCTCGTCCA...
Embodiment 2
[0135] The GFP-CD19 protein prepared in Example 1 was used to mark cells expressing CD19 molecules, so as to facilitate the identification and differentiation of related cells. To this end, the inventors measured and experimented with different types of cells infected with lentivirus, and the relevant experimental procedures are briefly introduced as follows.
[0136] Lentivirus infection of HEK 293 cells, Daudi and Jacket cells respectively
[0137] The day before the experiment, take 5×10 4 cells / mL HEK 293 cells were inoculated in 6 wells of a 24-well plate, 3 wells of the control group and 3 wells of the experimental group, respectively, and the inoculation volume was 500 µL;
[0138] Dilute polybrene with Enhanced Infection Solution (ENi.S) to a final concentration of 50 µg / mL; dilute lentiviral particles expressing CD19 antibody with ENi.S to a final concentration of 1×10 7 TU / mL;
[0139] After 12 hours of cell inoculation, replace the medium, add 500 µL of complete...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 