GFP-CD19 fusion protein and application thereof in cell marking aspect

A GFP-CD19, fusion protein technology, applied in the direction of fusion with spectral/fluorescence detection, hybrid peptide, recombinant DNA technology, etc., can solve problems such as increased risk, cytotoxicity, and increased immunogenicity

Active Publication Date: 2016-08-17
HENAN UNIVERSITY
View PDF0 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, foreign proteins may cause cytotoxicity or in...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • GFP-CD19 fusion protein and application thereof in cell marking aspect
  • GFP-CD19 fusion protein and application thereof in cell marking aspect
  • GFP-CD19 fusion protein and application thereof in cell marking aspect

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0057] GFP-CD19 fusion protein (green fluorescent protein), including 776 amino acids, molecular weight 85KD, its amino acid sequence is shown in SEQ ID NO.1. Since the acquisition of the protein is a key part of the implementation of the present invention, the preparation process of the protein is briefly introduced in this example as follows.

[0058] 1. Design primers, carry out PCR amplification, and obtain the gene sequence of CD19 molecule and the gene sequence of GFP molecule respectively;

[0059] The primer sequences used during PCR amplification of the gene sequence of the CD19 molecule are as follows:

[0060] Upstream primer: 5'- AGGATCCgaggaacctctagtggtgaagg-3',

[0061] Downstream primer: 5'-CAAGCTTtcacctggtgctccaggtgccc-3';

[0062] The primer sequences used during the PCR amplification of the gene sequence of the GFP molecule are as follows:

[0063] Upstream primer: 5'- GCATATGGTGAGCAAGGGCGAGGAG -3',

[0064] Downstream primer: 5'- AGGATCCCTTGTACAGCTCGTCCA...

Embodiment 2

[0135] The GFP-CD19 protein prepared in Example 1 was used to mark cells expressing CD19 molecules, so as to facilitate the identification and differentiation of related cells. To this end, the inventors measured and experimented with different types of cells infected with lentivirus, and the relevant experimental procedures are briefly introduced as follows.

[0136] Lentivirus infection of HEK 293 cells, Daudi and Jacket cells respectively

[0137] The day before the experiment, take 5×10 4 cells / mL HEK 293 cells were inoculated in 6 wells of a 24-well plate, 3 wells of the control group and 3 wells of the experimental group, respectively, and the inoculation volume was 500 µL;

[0138] Dilute polybrene with Enhanced Infection Solution (ENi.S) to a final concentration of 50 µg / mL; dilute lentiviral particles expressing CD19 antibody with ENi.S to a final concentration of 1×10 7 TU / mL;

[0139] After 12 hours of cell inoculation, replace the medium, add 500 µL of complete...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to view more

Abstract

The invention belongs to the technical field of cell marking and particularly relates to a GFP-CD19 fusion protein, a preparation method and application of the GFP-CD19 fusion protein in the cell marking aspect. The GFP-CD19 fusion protein comprises 776 amino acid, and the molecular weight is about 85 KD; the fusion protein is used for marking the cells with anti-CD19 bodies expressed on the surfaces. A specific combination principle of antigen-antibody or receptor-ligand is used, the GFP-CD19 fusion protein is specifically prepared, the protein can be specifically combined with a chimeric antigen receptor and is subjected to fluorescent marking, only T-lymphocyte which is effectively transfected and embedded with an antigen receptor can be combined with the protein so that the number of the effectively transfected T cells can be calculated by detecting the number of fluorescent cells, the number of effective T-lymphocyte returned to a patient body can be accurately controlled according to the data, and accordingly, guarantee is provided for treating the tumor with the CAR-T technology.

Description

technical field [0001] The invention belongs to the technical field of cell labeling, and in particular relates to a patent application for a method for preparing a GFP-CD19 fusion protein and its application in cell labeling. Background technique [0002] With the development of molecular immunology, people's understanding of the tumor immune process mediated by T cells is getting deeper and deeper; at the same time, the mechanism of T cells in tumor cell immune tolerance and tumor cell immune escape has aroused extensive interest of researchers with attention. As we all know, T lymphocytes play a very important role in the process of tumor immune monitoring and killing. However, due to the existence of various gene mutations or abnormal expression phenomena, tumor cells will express some molecules that normal tissue cells do not have, which are often called tumor molecular markers (markers) / tumor-specific antigens. In the process of attacking tumor cells, T lymphocytes n...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C07K19/00C12N15/70
CPCC07K14/70596C07K2319/60
Inventor 季少平房娜王凤玲赵伟郭向前肖曼王树真王豪杰
Owner HENAN UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap