Efficient hydrogen production functional gene carrier pet32a-fdhf and its construction and application

A gene carrier and gene technology, applied in the high-efficiency hydrogen production functional gene carrier pET32a-fdhF and its construction and application fields, can solve the problems of less hydrogen production, increased hydrogen production performance, and less hydrogen, and achieve improved Escherichia coli, hydrogen production The effect of improving efficiency

Active Publication Date: 2020-10-16
BEIJING UNIV OF TECH
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, wild Escherichia coli does not produce hydrogen or produces little hydrogen, which cannot meet human needs for energy. Therefore, genetic engineering or metabolic engineering methods are used to transform Escherichia coli to greatly increase its hydrogen production performance
The existing hydrogen-producing Escherichia coli consumes a lot of substrates, but produces relatively little hydrogen, and the efficiency is relatively low. It is urgent to introduce exogenous genes through transformation to greatly improve the hydrogen production efficiency, and the hydrogen production efficiency of different exogenous genes also different

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Efficient hydrogen production functional gene carrier pet32a-fdhf and its construction and application
  • Efficient hydrogen production functional gene carrier pet32a-fdhf and its construction and application
  • Efficient hydrogen production functional gene carrier pet32a-fdhf and its construction and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] (1) Search for the homologous gene sequence of Bacillus cereus formate dehydrogenase on NCBI, then combine the pET32a plasmid sequence, and use DNAMAN software to design primers for the formate dehydrogenase gene with the vector homologous sequence. The designed primers were handed over to Sangon Bioengineering (Shanghai) Co., Ltd. for primer synthesis.

[0025] The designed primers are:

[0026] Forward-Primer: AACTTTAAGAAGGAGATATACATatggcagaacagacagtccgtgtReverse-Primer:

[0027] CAGCCGGATCTCAGTGGTGGTGGTGGTGGTGCTCGAGGTCCACAAGTGATACGT

[0028] ATTGT

[0029] (2) According to the designed primers, the fdhF gene fragment was amplified by PCR technique. PCR condition settings: denaturation at 95°C for 30s, annealing at 58°C for 30s, extension at 72°C for 3 minutes, 30 cycles; 50uL system: 25uL 2*HiFi-PCR Master, 22uLddH2O, 1uLDAN template, 2uL upstream primer (10umol / L), 2uL downstream primer (10umol / L). (Ready-to-use PCR amplification kit, Shanghai Sangong)

[0030...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an efficient hydrogen-production functional gene vector pET32a-fdhF as well as construction and application thereof and relates to the technical field of genetic engineering. The gene vector pET32a-fdhF is a pET32a plasmid containing formate dehydrogenase fdhF genes of Bacillus cereus. The construction of the gene vector comprises the steps of amplifying segments of the formate dehydrogenase fdhF genes in Bacillus cereus by virtue of a design primer, linking the segments to a pET32a segment containing a corresponding linking terminal by virtue of recombinase, carrying out gene sequencing, and verifying the integrity of the genes. The pET32a-fdhF plasmid is converted into bacteria, and the bacteria are cultured in a hydrogen-production culture medium, so as to produce hydrogen. The pET32a-fdhF can be applied to different bacteria, so that the bacteria with no hydrogen-production capacity can produce hydrogen, the hydrogen-production of the bacteria capable of producing hydrogen is obviously improved, and more hydrogen can be rapidly produced by virtue of the same substrate concentration. According to the pET32a-fdhF, existing escherichia coli for industrial hydrogen production can be improved.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a high-efficiency hydrogen production functional gene carrier pET32a-fdhF and its construction and application. Background technique [0002] With the depletion of fossil energy reserves such as coal and oil, it is urgent to develop new energy sources, and hydrogen energy has attracted much attention as a clean and high-heat energy source. Although hydrogen energy can be obtained through chemical methods, it is controversial because of its high cost and possible environmental pollution. Biological hydrogen production can solve this problem. There are many microorganisms for biohydrogen production, among which Escherichia coli hydrogen production is one of the best choices in terms of cost and efficiency. At present, wild Escherichia coli does not produce hydrogen or produces little hydrogen, which cannot meet human needs for energy. Therefore, genetic engineering or ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/70C12N15/66C12N1/21C12P3/00C12R1/19
CPCC12N9/0008C12N15/66C12N15/70C12N2800/101C12P3/00C12Y102/01002
Inventor王海燕程水源刘伟赵雅琪徐岚婷王冕超
OwnerBEIJING UNIV OF TECH