Efficient hydrogen production functional gene carrier pet32a-fdhf and its construction and application
A gene carrier and gene technology, applied in the high-efficiency hydrogen production functional gene carrier pET32a-fdhF and its construction and application fields, can solve the problems of less hydrogen production, increased hydrogen production performance, and less hydrogen, and achieve improved Escherichia coli, hydrogen production The effect of improving efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] (1) Search for the homologous gene sequence of Bacillus cereus formate dehydrogenase on NCBI, then combine the pET32a plasmid sequence, and use DNAMAN software to design primers for the formate dehydrogenase gene with the vector homologous sequence. The designed primers were handed over to Sangon Bioengineering (Shanghai) Co., Ltd. for primer synthesis.
[0025] The designed primers are:
[0026] Forward-Primer: AACTTTAAGAAGGAGATATACATatggcagaacagacagtccgtgtReverse-Primer:
[0027] CAGCCGGATCTCAGTGGTGGTGGTGGTGGTGCTCGAGGTCCACAAGTGATACGT
[0028] ATTGT
[0029] (2) According to the designed primers, the fdhF gene fragment was amplified by PCR technique. PCR condition settings: denaturation at 95°C for 30s, annealing at 58°C for 30s, extension at 72°C for 3 minutes, 30 cycles; 50uL system: 25uL 2*HiFi-PCR Master, 22uLddH2O, 1uLDAN template, 2uL upstream primer (10umol / L), 2uL downstream primer (10umol / L). (Ready-to-use PCR amplification kit, Shanghai Sangong)
[0030...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


