Method of identifying molecules of culter alburnus, triangular bream and hybrid generation of culter alburnus and triangular bream
A technology of molecular identification and triangular bream, applied in the field of bioengineering, can solve problems such as difficult to accurately identify parents and hybrid offspring, mixed germplasm, and morphological identification is not necessarily accurate
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0018] The common primer pair 1 was designed according to the ITS1 sequence of the bream and bream published in GenBank, which can amplify the bream and bream. See Table 1 for the partial sequences of bream and hybrid progeny ITS1.
[0019] Table 1 General primer pair 1 for amplifying the partial sequence of ITS1 of bream, triangular bream and hybrid progeny
[0020] Primer Sequence (5'-3') base number Annealing temperature Forward AGTCGTAACAAGGTTTCCGTAG 22 49.9℃ reverse GCACGAGCCGAGTGATCCA 19 56.8℃
[0021] PCR was carried out with 50ng genomic DNA, 15mmol / L Tris-HCl, 50mmol / L KCl (pH8.0), 2mmol / LMgCl 2 , 200umol / L was carried out in a 25μl reaction system of dNTPs, 10μmol / L primers and 0.5U Taq DNA polymerase, the reaction conditions were 95°C for 3min, 30 cycles (94°C for 30s, 57°C for 30s, 72°C for 30s), 72°C Extend for 5 minutes and store at 4°C. The amplified PCR product was purified and connected to the pMD19-T vector, transforme...
Embodiment 2
[0029] The general primer pair 2 was designed according to the partial sequence of ITS1 of the bream and triangular bream obtained in Example 1, which can amplify the partial sequences of the ITS1 of the bream and triangular bream and the hybrid progeny. The general primer pair 2 is shown in Table 2.
[0030] Table 2 General primer pair 2 for amplifying the partial sequence of ITS1 of bream, triangular bream and hybrid progeny
[0031]
[0032] Genomic DNA was extracted from the fin rays of bream bream, triangular bream and their hybrid offspring, 30 fish of each species, 90 fish in total. PCR was carried out in a mixture containing 40ng DNA, 15mmol / L Tris-HCl, 50mmol / L KCl (pH8.0), 2mmol / L MgCl 2, 200umol / L was carried out in a 10μl reaction system of dNTPs, 10μmol / L primers and 0.5U Taq DNA polymerase. Extend for 5 minutes and store at 4°C. The PCR product was electrophoresed on 2% agarose gel, and the fragment of triangular bream was 256bp, the fragment of bream was 20...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com