Unlock instant, AI-driven research and patent intelligence for your innovation.

Method of identifying molecules of culter alburnus, triangular bream and hybrid generation of culter alburnus and triangular bream

A technology of molecular identification and triangular bream, applied in the field of bioengineering, can solve problems such as difficult to accurately identify parents and hybrid offspring, mixed germplasm, and morphological identification is not necessarily accurate

Active Publication Date: 2017-06-20
ZHEJIANG INST OF FRESH WATER FISHERIES
View PDF4 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, morphological identification is sometimes not necessarily accurate, and there are strong subjective factors. The morphological similarities between the bream and triangular bream are similar to the hybrid offspring. In the breeding process, especially at the seedling stage, traditional morphological identification methods are difficult to be accurate Distinguish between parents and hybrid progeny, thus prone to mix-up of germplasm

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method of identifying molecules of culter alburnus, triangular bream and hybrid generation of culter alburnus and triangular bream
  • Method of identifying molecules of culter alburnus, triangular bream and hybrid generation of culter alburnus and triangular bream

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] The common primer pair 1 was designed according to the ITS1 sequence of the bream and bream published in GenBank, which can amplify the bream and bream. See Table 1 for the partial sequences of bream and hybrid progeny ITS1.

[0019] Table 1 General primer pair 1 for amplifying the partial sequence of ITS1 of bream, triangular bream and hybrid progeny

[0020] Primer Sequence (5'-3') base number Annealing temperature Forward AGTCGTAACAAGGTTTCCGTAG 22 49.9℃ reverse GCACGAGCCGAGTGATCCA 19 56.8℃

[0021] PCR was carried out with 50ng genomic DNA, 15mmol / L Tris-HCl, 50mmol / L KCl (pH8.0), 2mmol / LMgCl 2 , 200umol / L was carried out in a 25μl reaction system of dNTPs, 10μmol / L primers and 0.5U Taq DNA polymerase, the reaction conditions were 95°C for 3min, 30 cycles (94°C for 30s, 57°C for 30s, 72°C for 30s), 72°C Extend for 5 minutes and store at 4°C. The amplified PCR product was purified and connected to the pMD19-T vector, transforme...

Embodiment 2

[0029] The general primer pair 2 was designed according to the partial sequence of ITS1 of the bream and triangular bream obtained in Example 1, which can amplify the partial sequences of the ITS1 of the bream and triangular bream and the hybrid progeny. The general primer pair 2 is shown in Table 2.

[0030] Table 2 General primer pair 2 for amplifying the partial sequence of ITS1 of bream, triangular bream and hybrid progeny

[0031]

[0032] Genomic DNA was extracted from the fin rays of bream bream, triangular bream and their hybrid offspring, 30 fish of each species, 90 fish in total. PCR was carried out in a mixture containing 40ng DNA, 15mmol / L Tris-HCl, 50mmol / L KCl (pH8.0), 2mmol / L MgCl 2, 200umol / L was carried out in a 10μl reaction system of dNTPs, 10μmol / L primers and 0.5U Taq DNA polymerase. Extend for 5 minutes and store at 4°C. The PCR product was electrophoresed on 2% agarose gel, and the fragment of triangular bream was 256bp, the fragment of bream was 20...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method of identifying molecules of culter alburnus, triangular bream and a hybrid generation of culter alburnus (female) and triangular bream (male), and belongs to the technical field of molecular biology. According to the method, by selecting genes of first internal transcribed spacers (ITS1) of ribosome DNA of the culter alburnus, the triangular bream and the hybrid generation of the culter alburnus and the triangular bream, the genes have remarkable difference in the size of amplified fragments of three types of fish; and a pair of universal primers are designed, and the culter alburnus, the triangular bream and the hybrid generation of the culter alburnus and the triangular bream are distinguished by amplifying the ITS1 region by PCR. The method established by the invention has strong specificity and high reliability and can be applied to variety identification of the culter alburnus, the triangular bream and the hybrid generation of the culter alburnus and the triangular bream.

Description

technical field [0001] The invention relates to a method for molecular identification of bream, bream and their hybrid offspring [bream (♀) × bream (♂)], belonging to the field of bioengineering. Background technique [0002] The bream and the triangular bream are important economic fish belonging to the genus bream and the genus bream respectively in the subfamily of bream. The former is a pelagic fish with a slender body and carnivorous nature. However, there are many spines between the muscles, the cost of artificial breeding is high, and the temperament is impatient, so it is difficult to catch and transport live fish; the latter is a middle-lower fish with a generous body shape. Bream has the characteristics of miscellaneous feeding habits, low breeding cost, gentle temperament, easy fishing and live fish marketing, but it has high requirements on the quality of breeding water and its management level. The crossbream and triangular bream are highly complementary in ter...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/6869C12Q1/6888C12Q2531/113C12Q2565/125
Inventor 蒋文枰顾志敏贾永义刘士力迟美丽郭建林唐永凯李建林
Owner ZHEJIANG INST OF FRESH WATER FISHERIES