Unlock instant, AI-driven research and patent intelligence for your innovation.

Fusion protein of alpha-melanophore stimulating hormone and preparation method and application thereof

A technology of fusion protein and melanocytes, which is applied in the field of fusion protein of α-melanocyte-stimulating hormone and its preparation, can solve problems such as inability to achieve stable and high-efficiency expression of α-MSH, numerous influencing factors, and prolong half-life, so as to achieve the goal of treating cerebral palsy Inflammation and related diseases, ensuring biological activity, and prolonging the effect of half-life

Active Publication Date: 2017-06-30
LANZHOU UNIVERSITY
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] Although it is disclosed in the prior art that the half-life of the target protein can be extended through the expression strategy of the fusion protein, the design of the fusion protein itself is a process with complex procedures and many influencing factors, and it is impossible to achieve α- The purpose of the stable and efficient expression of MSH and the extension of its half-life is well known to those skilled in the art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fusion protein of alpha-melanophore stimulating hormone and preparation method and application thereof
  • Fusion protein of alpha-melanophore stimulating hormone and preparation method and application thereof
  • Fusion protein of alpha-melanophore stimulating hormone and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] Construction and expression of the fusion protein yeast expression vector of embodiment 1 pPINKα-HC / PTD-HSA-L-α-MSH and pPINKα-HC / HSA-L-α-MSH

[0058] 1. Construction of pPINKα-HC / PTD-HSA-L-α-MSH vector

[0059] 1. Design PCR primers:

[0060] NFT1: TCTCTCGAGAAAAGGTACGGTAGAAAAGAAACGTAGACAAAAGACGTAGA

[0061] NFT2:GAAAGAAACGTAGACAAAAGACGTAGA GATGCACACAAGAGTGAG

[0062] R2: GCTCCATAGAGTAAGAACCAGATCCACCTCCAGAACCTCCACCTCCTAAGCCTAAGGCAGCTTG

[0063] R1:TTAAATGGCCGGCCGGTACCttaAACTGGCTTACCCCATCTAAAGTGTCCCATAGAGTAAGAAC

[0064] 2. The first round of PCR amplification: pcDNA3.1-HSA plasmid DNA was used as a template, and NFT2 and R2 were used as upstream and downstream primers, respectively, for PCR amplification. The reaction conditions are as follows: ① Denaturation: 94°C, 5min; ② Denaturation: 94°C, 1min; ③ Refolding: 55°C, 30S; ④ Extension: 72°C, 2min; ⑤ Return to step "②" for 35 cycles; ⑥ Extend : 72°C, 5min, the total number of cycles is 30 times. The PCR product was...

Embodiment 2

[0076] Example 2 Verification of PTD-HSA-L-α-MSH crossing the blood-brain barrier function

[0077] Experimental Materials

[0078] 1. Experimental equipment

[0079] Syringe, pipette gun, centrifuge (Hitachi), ultrapure water instrument (Millipore), ultrasonic instrument, constant temperature culture

[0080] Breeding box (Shanghai Yiheng), microplate reader (Thermo), etc. HSA Elisa kit (Cygnus Technologies)

[0081] 2. Experimental animals

[0082] Ten standard weight Kunming mice were purchased from the Experimental Animal Center of Lanzhou University.

[0083] 3. Experimental method

[0084] Grouping and administration of mice:

[0085]Ten Kunming mice were randomly divided into two groups with a body weight of about 18-22 g: 1-control group (injected with HSA-L-α-MSH), 2-alpha melanocyte-stimulating hormone fusion protein group (injected with PTD-HSA -L-α-MSH).

[0086] The control group was injected with tail vein (150uL, 1μm / kg) HSA-L-α-MSH. In the fusion prote...

Embodiment 3

[0091] Example 3 Research on biological activity of PTD-HSA-L-α-MSH

[0092] Experimental Materials

[0093] 1. Experimental equipment

[0094] Syringe, pipette gun, centrifuge (Hitachi), ultrapure water instrument (Millipore), ultrasonic instrument, constant temperature culture

[0095] Breeding box (Shanghai Yiheng), microplate reader (Thermo), etc. TNF-a Elisa Kit (for Daktronics)

[0096] 2. Experimental animals

[0097] Twenty standard weight Kunming mice were purchased from the Experimental Animal Center of Lanzhou University.

[0098] 3. Experimental method

[0099] Grouping and administration of mice:

[0100] Lipopolysaccharide LPS (Lipopolysaccharides) is Gram-negative bacterial endotoxin, which is a component of the cell wall of Gram-negative bacteria. Injecting LPS into the lateral ventricle of mice can cause neurodegeneration and inflammatory reactions in the brain. In this experiment, mouse brain The tumor necrosis factor (tumor necrosis factors a, TNF-a) ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention belongs to the field of genetic engineering pharmaceutics, and particularly relates to a fusion protein of alpha-melanophore stimulating hormone. The fusion protein comprises a PTD (protein transduction domain), an HSA (albumin human) and an alpha-MSH (alpha-melanocyte stimulating hormone). The fusion protein has the advantages that by adding a flexible connecting peptide between the alpha-MSH and the HSA, the high-level stable expression of the fusion protein in a host is guaranteed; while the biological activity of the alpha-MSH is maintained, a blood brain barrier can be effectively crossed, and the medicine effect is improved; the effect of delaying a half-life period is realized. The invention also provides a preparation method of the fusion protein, and application of the fusion protein in inhibiting or treating central nervous system inflammation.

Description

technical field [0001] The invention belongs to the field of genetic engineering pharmacy, and in particular relates to a fusion protein of alpha melanocyte-stimulating hormone and its preparation method and application. Background technique [0002] Brain tissue damage caused by vascular injury, inflammation, and trauma can lead to cognitive dysfunction, which seriously affects people's quality of life and work efficiency. At present, most of the clinical drugs for the above diseases focus on the repair and protection of brain nerve tissue. In fact, in addition to nerve cells, astrocytes, oligodendrocytes, endothelial cells, and microglia also need to be repaired after injury. repair. The endogenous immune neuromodulatory peptide α-Melanocyte stimulating hormone (α-Melanocytestimulating hormone, α-MSH) has potential anti-inflammatory, neurotrophic and anti-apoptotic effects. It has significant therapeutic potential for the above diseases, and has less side effects than tr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K19/00C12N15/81C12N1/19A61K38/34A61K47/64A61P29/00A61P25/00C12R1/84
CPCA61K38/00C07K14/685C07K2319/10C07K2319/31C12N15/62
Inventor 李红玉王梅竹支德娟李洋王娜刘怡瑶裴月娟宋美娟杨洋
Owner LANZHOU UNIVERSITY