Detection kit for auxiliary diagnosis of cerebral arteriovenous malformation and application of detection kit
A detection kit, arteriovenous malformation technology, applied in the direction of determination/inspection of microorganisms, biochemical equipment and methods, etc., can solve the problem of non-disclosure, etc., and achieve the effect of strong pertinence and high detection efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0018] The present invention will be further described in detail below in conjunction with the accompanying drawings and embodiments.
[0019] A detection kit for auxiliary diagnosis of cerebral arteriovenous malformation, the detection kit includes a pair of CDKN2A Gene promoter region methylation-specific amplification primers and a methylation-specific sequencing primer:
[0020] Nucleotide sequences of methylation-specific upstream primers:
[0021] 5'-GTTGGAAAATGAATGTTTTGAGTTT-3';
[0022] Nucleotide sequences of methylation-specific downstream primers:
[0023] 5'-Biotin- ACCCCTAAACCTAACTAAAAAACTAAACC -3';
[0024] Nucleotide sequences of methylation-specific sequencing primers:
[0025] 5'-GGTTATTGTTTTTGGTGT-3'.
[0026] Application of a detection kit for auxiliary diagnosis of cerebral arteriovenous malformation, the detection kit can be used for auxiliary diagnosis, detection or screening of drugs for cerebral arteriovenous malformation.
[0027] 1. Collection o...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com