Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Detection kit for auxiliary diagnosis of cerebral arteriovenous malformation and application of detection kit

A detection kit, arteriovenous malformation technology, applied in the direction of determination/inspection of microorganisms, biochemical equipment and methods, etc., can solve the problem of non-disclosure, etc., and achieve the effect of strong pertinence and high detection efficiency

Inactive Publication Date: 2017-08-18
NINGBO FIRST HOSPITAL
View PDF1 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, there is no published information on the detection of cerebral arteriovenous malformations at home and abroad. CDKN2A Relevant research reports on kits for the degree of methylation in gene promoter regions

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection kit for auxiliary diagnosis of cerebral arteriovenous malformation and application of detection kit
  • Detection kit for auxiliary diagnosis of cerebral arteriovenous malformation and application of detection kit
  • Detection kit for auxiliary diagnosis of cerebral arteriovenous malformation and application of detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0018] The present invention will be further described in detail below in conjunction with the accompanying drawings and embodiments.

[0019] A detection kit for auxiliary diagnosis of cerebral arteriovenous malformation, the detection kit includes a pair of CDKN2A Gene promoter region methylation-specific amplification primers and a methylation-specific sequencing primer:

[0020] Nucleotide sequences of methylation-specific upstream primers:

[0021] 5'-GTTGGAAAATGAATGTTTTGAGTTT-3';

[0022] Nucleotide sequences of methylation-specific downstream primers:

[0023] 5'-Biotin- ACCCCTAAACCTAACTAAAAAACTAAACC -3';

[0024] Nucleotide sequences of methylation-specific sequencing primers:

[0025] 5'-GGTTATTGTTTTTGGTGT-3'.

[0026] Application of a detection kit for auxiliary diagnosis of cerebral arteriovenous malformation, the detection kit can be used for auxiliary diagnosis, detection or screening of drugs for cerebral arteriovenous malformation.

[0027] 1. Collection o...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a detection kit for auxiliary diagnosis of cerebral arteriovenous malformation and application of the detection kit. The detection kit comprises a pair of CDKN2A gene promoter region methylation specific amplification primers and a methylation specific sequencing primer, wherein the upstream primer has a nucleotide sequence as shown in SEQ ID NO. 1; the downstream primer has a nucleotide sequence as shown in SEQ ID NO. 2; the methylation specific sequencing primer is as shown in SEQ ID NO. 3. The detection kit has the advantages that detection of cerebral arteriovenous malformation can be conveniently and quickly realized in the molecular level, the detection efficiency is high, the detection kit is highly targeted, and meanwhile, a medicine taking CDKN2A gene promoter region methylation as the target is expected to become a new measure for auxiliary diagnosis, detection and screening of cerebral arteriovenous malformation.

Description

technical field [0001] The present invention relates to the technical field of auxiliary diagnosis of cerebral arteriovenous malformations, in particular to a detection kit for auxiliary diagnosis of cerebral arteriovenous CDKN2A Kit for methylation degree of gene promoter region and application thereof. Background technique [0002] Brain arteriovenous malformation (Brain arteriovenous malformation, BAVM) refers to the abnormal expansion of brain arteries and veins, which leads to hemodynamic disorder in the brain, forming chaotic blood vessel groups; BAVM is a congenital disease, mainly due to embryonic development. It is caused by the variation of cerebral blood vessel formation during the process, and the deformed blood vessel group can continue to grow along with the development of the human body. Through compression, stimulation, shunting of blood supply or bleeding, it can damage peripheral nerve tissue, cause various neurological dysfunction and even endanger life. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/6883C12Q2600/136C12Q2600/154
Inventor 黄毅高翔孙杰聂晟
Owner NINGBO FIRST HOSPITAL
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More