Application and seamless cloning method of DNA exonuclease

A seamless cloning and exonuclease technology, applied in the field of molecular biology, can solve the problems of low recovery efficiency, increased cost, high false positive, etc., and achieve the effect of high enzyme cutting efficiency

Pending Publication Date: 2018-03-06
NOVOPROTEIN SCI INC
View PDF2 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, the shortcoming of this kind gene cloning technology method always exists: (1) the two ends of carrier and object fragment will have identical restriction enzyme cutting site; (2) the recovery efficiency after vector and fragment digestion is too low; ( 3) Easy self-ligation, high false positive; (4) Subcloning is required if ligated to T vector; (5) Insertion direction needs to be identified during blunt-end ligation, which has not been effectively resolved
However, this technology mainly relies on recombinant enzymes. There are many types of recombinant enzymes on the market, and the quality is also uneven. Some products have recombinant enzymes that are mixed enzymes, which undoubtedly increases the cost.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application and seamless cloning method of DNA exonuclease
  • Application and seamless cloning method of DNA exonuclease
  • Application and seamless cloning method of DNA exonuclease

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] 1. Linearization of the cloning vector

[0064] According to the gene sequence of the pUC19 plasmid, the synthetic PUC19-F primer and PUC19-R primer were used for PCR amplification. The PCR used the company's high-fidelity amplification system (E035, Novoprotein), and the reaction system was prepared according to the requirements of the instructions.

[0065] The synthetic primer sequences are as follows:

[0066] PUC19-F:GAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTG;

[0067] PUC19-R: GTCGACCTGCAGGCATGCAAGCTTGGCGTAATCATGGTCATAG.

[0068] PCR reaction conditions were: step ① 94 degrees Celsius for 5 minutes; step ② 94 degrees Celsius for 20 seconds, 55 degrees Celsius for 20 seconds, 72 degrees Celsius for 90 seconds, 30 cycles; step ③ 72 degrees Celsius for 5 minutes. The PCR product was recovered and detected by 1% agarose gel electrophoresis to obtain a single band of the correct size, such as figure 1 .

[0069] 2. Obtaining the target DNA fragment

[0070] A...

Embodiment 2

[0088] 1. Linearization of the cloning vector

[0089] According to the gene sequence of the pUC19 plasmid, the synthetic PUC19-F primer and PUC19-R primer were used for PCR amplification. The PCR used the company's high-fidelity amplification system (E035, Novoprotein), and the reaction system was prepared according to the requirements of the instructions.

[0090] The synthetic primer sequences are as follows:

[0091] PUC19-F: GAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTG’

[0092] PUC19-R:

[0093] GTCGACCTGCAGGCATGCAAGCTTGGCGTAATCATGGTCATAG

[0094] PCR reaction conditions were: step ① 94 degrees Celsius for 5 minutes; step ② 94 degrees Celsius for 20 seconds, 55 degrees Celsius for 20 seconds, 72 degrees Celsius for 90 seconds, 30 cycles; step ③ 72 degrees Celsius for 5 minutes. The PCR product was recovered and detected by 1% agarose gel electrophoresis to obtain a single band with the correct size (such as Figure 5 ).

[0095] 2. Obtaining the target DNA fragme...

Embodiment 3

[0114] 1. Linearization of the cloning vector

[0115] According to the gene sequence of the pUC19 plasmid, the synthetic PUC19-F primer and PUC19-R primer were used for PCR amplification. The PCR used the company's high-fidelity amplification system (E035, Novoprotein), and the reaction system was prepared according to the requirements of the instructions.

[0116] The synthetic primer sequences are as follows:

[0117] PUC19-F: GAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTG’

[0118] PUC19-R:

[0119] GTCGACCTGCAGGCATGCAAGCTTGGCGTAATCATGGTCATAG

[0120] PCR reaction conditions were: step ① 94 degrees Celsius for 5 minutes; step ② 94 degrees Celsius for 20 seconds, 55 degrees Celsius for 20 seconds, 72 degrees Celsius for 90 seconds, 30 cycles; step ③ 72 degrees Celsius for 5 minutes. The PCR product was recovered and detected by 1% agarose gel electrophoresis to obtain a single band with the correct size (such as Figure 9 ).

[0121] 2. Obtaining the target DNA fragme...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides application of DNA exonuclease to DNA recombinant seamless cloning and provides a kit capable of being used for DNA recombinant seamless cloning. The DNA exonuclease is T5 exonuclease, T7 exonuclease, exonuclease III or Lambda exonuclease or a mixture thereof. The invention further provides a seamless cloning method applying the DNA exonuclease, which comprises the followingsteps: linearizing a vector through a PCR method or restriction endonuclease digestion; introducing homologous sequences that are respectively homologous to the two ends of the vector at the two endsof a target gene fragment through PCR to obtain an amplified target gene fragment; after the treated target fragment and the treated linearized vector are mixed, adding the DNA exonuclease and a reaction solution for temperature bath to obtain a vector and fragment mixture; converting an echerichia coli receptive cell by using the obtained vector and fragment mixture. The application and the method provided by the invention have the following advantages that the site selection can be flexibly performed, and the gene cloning can be performed in any position of the vector; the vector construction can be quickly, simply and conveniently completed within 10 minutes; meanwhile, the cloning is accurate and efficient.

Description

technical field [0001] The present invention relates to molecular biology, in particular to a seamless cloning method of DNA recombination. Background technique [0002] In the 1970s, the Boyer-Cohen experiment successfully constructed a double-drug-resistant recombinant plasmid, the prelude to genetic engineering, and then O.Smith discovered the first restriction endonuclease. So far, the most traditional is also The most classic gene cloning technology - Ligation-dependent cloning technology was born. The ligation-dependent cloning technique uses restriction endonucleases to treat the vector and PCR product fragments to produce the same cohesive ends, and then ligates into a circle under the action of DNA ligase to transform the host cells. As one of the most important technologies in the field of biology, gene cloning technology has always had huge market potential and prospects. Many well-known enterprises and companies such as NEB, Novagen, Thermo scientific, etc. have...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/70C12N15/66
CPCC12N15/66C12N15/70
Inventor赵曼曼张清仪金秋
OwnerNOVOPROTEIN SCI INC