Internal reference amplification primer composition for detecting NPPA gene mutation c.T413C and amplification system thereof
An amplification primer and amplification system technology, applied in the field of molecular biology, can solve the problems of expensive detection equipment, time-consuming and labor-intensive, difficult to popularize, etc., and achieve the effects of simple and easy detection method, reduced burden, and clear results.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] This example is the target sequence of the NPPA gene mutation c.T413C used in the present invention, and the internal reference amplification primers used to detect the NPPA gene mutation.
[0027] Select the target sequence to design primers, and after a large number of optimization screening, design appropriate specific primers.
[0028] The length of the target sequence is 102bp, and the specific sequence is:
[0029] gagatccagctgcttcgggggcaggatggacaggattggagcccagagcggactgggctgtaacagcttccgggtaagaggaactggggatggaaatgggat.
[0030] The primer sequences are:
[0031] F1: 5'-acagtcagccgcatcttctt-3', (SEQ ID NO.1),
[0032] R1: 5'-acgaccaaatccgttgactc-3', (SEQ ID NO.2);
[0033] F2: 5'-gagatccagctgcttcggggg-3', (SEQ ID NO.3),
[0034] R2: 5'-atcccatttccatccccagttcct-3', (SEQ ID NO. 4).
Embodiment 2
[0036] This embodiment is an internal reference amplification system, kit and amplification detection method for detecting NPPA gene mutations of the present invention.
[0037] The test kit for detecting NPPA gene mutation of the present invention includes an internal reference amplification system whose total volume is 20 μL, which includes 10 μL of 2× reaction buffer (RM), 0.8 μL of primer F1 (final concentration is 1.6 μM), primer R10.8μL (final concentration 1.6μM), primer F2 0.8μL (final concentration 1.6μM), primer R20.8μL (final concentration 1.6μM), DNA polymerase (8U / μL) 0.5μL, Calcein (FD, 0.4 μM) 1 μL, deionized water 4.3 μL, DNA template (20ng / μL) 2 μL.
[0038] Use the above system to carry out LAMP reaction, the LAMP reaction conditions are: 60°C, 40min; the equipment used is an ordinary PCR instrument or a water bath that can stably provide a constant temperature of 60°C; then perform visual interpretation to identify whether the sample is positive for NPPA gen...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com


