Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Internal reference amplification primer composition for detecting NPPA gene mutation c.T413C and amplification system thereof

An amplification primer and amplification system technology, applied in the field of molecular biology, can solve the problems of expensive detection equipment, time-consuming and labor-intensive, difficult to popularize, etc., and achieve the effects of simple and easy detection method, reduced burden, and clear results.

Inactive Publication Date: 2018-05-04
HUBEI UNIV OF TECH
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] At present, the detection of gene mutations mainly relies on probe real-time PCR or sequencing methods, etc. The above methods are time-consuming and labor-intensive, have a long reporting period, and have defects in sensitivity. The required detection equipment is expensive, and special equipment must be required for detection. And well-trained technical personnel, high requirements on the technical platform, it is not easy to widely promote

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Internal reference amplification primer composition for detecting NPPA gene mutation c.T413C and amplification system thereof
  • Internal reference amplification primer composition for detecting NPPA gene mutation c.T413C and amplification system thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] This example is the target sequence of the NPPA gene mutation c.T413C used in the present invention, and the internal reference amplification primers used to detect the NPPA gene mutation.

[0027] Select the target sequence to design primers, and after a large number of optimization screening, design appropriate specific primers.

[0028] The length of the target sequence is 102bp, and the specific sequence is:

[0029] gagatccagctgcttcgggggcaggatggacaggattggagcccagagcggactgggctgtaacagcttccgggtaagaggaactggggatggaaatgggat.

[0030] The primer sequences are:

[0031] F1: 5'-acagtcagccgcatcttctt-3', (SEQ ID NO.1),

[0032] R1: 5'-acgaccaaatccgttgactc-3', (SEQ ID NO.2);

[0033] F2: 5'-gagatccagctgcttcggggg-3', (SEQ ID NO.3),

[0034] R2: 5'-atcccatttccatccccagttcct-3', (SEQ ID NO. 4).

Embodiment 2

[0036] This embodiment is an internal reference amplification system, kit and amplification detection method for detecting NPPA gene mutations of the present invention.

[0037] The test kit for detecting NPPA gene mutation of the present invention includes an internal reference amplification system whose total volume is 20 μL, which includes 10 μL of 2× reaction buffer (RM), 0.8 μL of primer F1 (final concentration is 1.6 μM), primer R10.8μL (final concentration 1.6μM), primer F2 0.8μL (final concentration 1.6μM), primer R20.8μL (final concentration 1.6μM), DNA polymerase (8U / μL) 0.5μL, Calcein (FD, 0.4 μM) 1 μL, deionized water 4.3 μL, DNA template (20ng / μL) 2 μL.

[0038] Use the above system to carry out LAMP reaction, the LAMP reaction conditions are: 60°C, 40min; the equipment used is an ordinary PCR instrument or a water bath that can stably provide a constant temperature of 60°C; then perform visual interpretation to identify whether the sample is positive for NPPA gen...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an internal reference amplification primer composition for detecting NPPA gene mutation c.T413C and an amplification system thereof, and belongs to the field of molecular biology. The internal reference amplification primer composition comprises primers with sequences as shown in SEQ ID NO.1-4. The internal reference amplification system comprises the primer composition. The invention also discloses a kit comprising the internal reference amplification system and a detection method. The primers shown as in SEQ ID NO.1-4 are adopted to perform LAMP (Loop-Mediated Isothermal Amplification) reaction, and whether a sample is in a positive state of NPPA gene mutation c.T413C can be identified by virtue of visual interpretation. The internal reference amplification systemand the detection method thereof disclosed by the invention are matched with an NPPA gene mutation system to be used, the detection method is simple, convenient and easy, low in cost, efficient and fast as well as clear in result, the burden of patients can be greatly relieved, and a reference is provided for medication of patients suffering from atrial fibrillation.

Description

technical field [0001] The invention relates to the field of molecular biology, in particular to an internal reference amplification primer composition and an amplification system for detecting NPPA gene mutation c.T413C. Background technique [0002] Atrial fibrillation (AF) is one of the most common arrhythmia diseases clinically, and is an independent risk factor for various cardiovascular diseases. Serious consequences such as tachycardia, ventricular arrhythmia and even death are extremely harmful to public health. [0003] With the development of molecular medicine, atrial fibrillation is considered to be the result of the joint action of genetic factors and environmental factors. Although the control of environmental factors can delay the onset and prognosis of atrial fibrillation to a certain extent, the lack of understanding of inherent genetic factors has greatly hindered the research and judgment of atrial fibrillation. [0004] Studies in recent years have show...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6883C12N15/11C12N15/63
CPCC12N15/63C12Q1/6883C12Q2600/156C12Q2600/166
Inventor 黄渊唐景峰陈兴珍周策凡
Owner HUBEI UNIV OF TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com