Multicopper oxidase recombinase capable of degrading biogenic amine

A technology of multi-copper oxidase and biogenic amine, applied in the field of fermentation, can solve the problems of poor degradation effect and few degradation types, and achieve the effects of improved safety, wide degradation spectrum and obvious degradation effect.

CN108165515AActive Publication Date: 2018-06-15JIANGNAN UNIV
1 Cites 11 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Publication Date
2018-06-15

Smart Images

  • Figure 1
    Figure 1
  • Figure 2
    Figure 2
  • Figure 3
    Figure 3
Patent Text Reader

Abstract

The invention discloses a multicopper oxidase recombinase capable of degrading biogenic amine, and belongs to the technical field of fermentation. According to a degradation method, an appropriate amount of the multicopper oxidase recombinase is added into soy sauce, biogenic amine is degraded by the multicopper oxidase recombinase into aldehydes and ammonias, and degradation of biogenic amine isrealized, wherein the multicopper oxidase recombinase is obtained via heterologous expression of multicopper oxidase recombinase genes from Lactobacillus paracasei in Escherichia coli. The multicopperoxidase recombinase possesses relatively excellent biogenic amine degradation capacity, is capable of degrading tryptamine, phenylethylamine, putrescine, cadaverine, histamine, tyramine, spermine, and spermidine in 24h, and the highest degradation efficiency is 75%.
Need to check novelty before this filing date? Find Prior Art

Description

technical field

[0001] The invention relates to a multi-copper oxidase recombination enzyme capable of degrading biogenic amine, which belongs to the technical field of fermentation. Background technique

[0002] Soy sauce is a unique condiment in my country and Southeast Asian countries. It uses soybeans, wheat or bran as raw materials, and uses microorganisms such as Aspergillus oryzae, yeast, and lactic acid bacteria to produce a liquid condiment with special color, aroma, and taste through fermentation. Soy sauce is rich in protein and a large amount of free amino acids, which will generate biogenic amines under the action of amino acid decarboxylase.

[0003] Biogenic amine is a general term for a class of biologically active small molecular weight nitrogen-containing organic compounds. When ingesting a variety of biogenic amines, it can cause allergic reactions such as headache, nausea, palpitations, changes in blood pressure, respiratory disturbances, etc., and even ...

Examples

Embodiment 1

[0026] According to the gene sequence of multi-copper oxidase in Lactobacillus paracasei strain L9 (GenBank accession number: CP012148.1) in NCBI, primers were designed, and the genome of Lactobacillus paracasei (Lactobacillus paracasei) preserved in our laboratory was used as a template to amplify Increased copper oxidase gene. The primers required for amplification are as follows:

[0027] Upstream: ATGAAAACCTATACGGACTATTTC

[0028] Downstream: TTA CATTTTCATCCCCATTT

[0029] PCR reaction program: pre-denaturation at 95°C for 3 min, and then the following cycle: denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min and 30 s; after 34 cycles, extension at 72°C for 10 min, at 4°C insulation.

[0030] Using the genome of Lactobacillus paracasei as a template, PCR amplification was performed, and the amplification results were displayed by 1% agarose gel electrophoresis after the amplification, such as figure 1 A band of about 1500bp is shown,...

Embodiment 2

[0032] 1. Obtaining the target fragment: using the genome of Lactobacillus paracasei as a template, after the PCR amplification is completed, the amplification result is displayed by 1% agarose gel electrophoresis, and there is a target band of about 1500bp. Purify the PCR product with a DNA gel extraction kit to obtain the target fragment.

[0033] 2. Obtain the vector: Streak the Escherichia coli containing the plasmid pET-28a onto the LB plate containing kanamycin. element), 200r·min at 37°C -1 Cultivate overnight and extract the plasmid using a plasmid extraction kit.

[0034] 3. Enzyme digestion and ligation: select appropriate restriction enzymes EcoRI and HindIII according to the sequence of the gene and the vector, and react in a metal bath at 37°C for 45 minutes.

[0035] Table 1 50 μL restriction endonuclease digestion reaction system

[0036]

[0037] After the digested gene fragments and plasmids were recovered and purified, they were mixed at a molar ratio o...

Embodiment 3

[0044] Mix 2ml of crude enzyme solution with 2mL of a certain brand of commercially available soy sauce, place the mixture in a 37°C incubator for 48 hours, then centrifuge at 4°C and 10000r / min for 5min to get the supernatant, and use HPLC to detect the content of biogenic amines. content. In the control group, PBS buffer solution was used instead of crude enzyme solution and soy sauce to mix and co-place.

[0045] Table 1 Content of biogenic amines in soy sauce

[0046]