Unlock instant, AI-driven research and patent intelligence for your innovation.

Saccharopolyspora hordei sourced copper-containing amine oxidase capable of degrading biogenic amine and application thereof

A copper amine oxidase and recombinant microorganism technology, applied in the field of molecular biology, can solve the problem of high biogenic amines and achieve the effect of improving safety

Active Publication Date: 2021-08-13
JIANGNAN UNIV +2
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The purpose of the present invention is to solve the problem of high content of biogenic amines in existing traditional fermented foods, to provide a copper-containing amine oxidase derived from Saccharopolyspora hallii that can degrade biogenic amines, and to degrade biological amines with copper-containing amine oxidase. amine method to reduce biogenic amines in rice wine, soy sauce and other fermented foods, and improve the quality of traditional fermented foods

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Saccharopolyspora hordei sourced copper-containing amine oxidase capable of degrading biogenic amine and application thereof
  • Saccharopolyspora hordei sourced copper-containing amine oxidase capable of degrading biogenic amine and application thereof
  • Saccharopolyspora hordei sourced copper-containing amine oxidase capable of degrading biogenic amine and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Example 1: PCR amplification of the copper amine oxidase gene in S.hordei F2002

[0046] Primers were designed according to the amine oxidase gene (Protein ID: WP_179723446.1) in Saccharopolyspora hordei in the NCBI database, and the S. hordei F2002 genome preserved in our laboratory was used as a template to amplify the multi-copper oxidase gene. The primers required for amplification are as follows: the upper primer sequence (5'→3') is ATGGCGATGCACCCGCTGGAT; the lower primer sequence (5'→3') is TCAGGACTCGCAGCAGTGGG. according to Requirements for the reaction system of HS DNA Polymerase with GC Buffer Prepare a PCR reaction solution. The PCR amplification system is as follows: pre-denaturation at 98°C for 10s, annealing at 55°C for 30s, extension at 72°C (1min·kb -1 ) cycle 30 times.

[0047] Using the genome of S.hordei F2002 as a template, PCR amplification was carried out, and the PCR product was verified by 1% agarose gel electrophoresis. figure 1 The size of th...

Embodiment 2

[0048] Example 2: Genetically engineered bacteria E.coli BL21-pET28a-CuAO Shod build

[0049] (1) Obtain the target fragment.

[0050] Using the whole genome sequence of S.hordei F2002 as a template, the primers and the whole genome DNA are used to complete PCR amplification. The PCR reaction system and amplification procedure are the same as those described in Example 1, and the correct PCR product gel is carefully cut for band verification. , recovered and purified.

[0051] (2) Digestion and ligation.

[0052] The plasmid pET-28a(+) and the target fragment were double-digested with restriction endonuclease Nde I and EcoR I respectively. The restriction enzyme digestion system was as follows: 40 μL of target gene fragment, 40 μL of plasmid, I and EcoR I each 2.5 μL, Green Buffer 5 μL. The components in the enzymatic cleavage system were thoroughly mixed, and then placed in a metal bath at 37°C for 45 minutes of reaction. After recovery and purification, the double-diges...

Embodiment 3

[0057] Embodiment 3: Recombinase CuAO Shod induced expression and purification

[0058] (1) Recombinase CuAO Shod induced expression of

[0059] Inoculate the recombinant bacteria liquid with 1% inoculum to contain 50 mg·L -1 In LB medium of ampicillin, at 37°C, 150r·min -1 Conditioned for 12h. The seed solution was transferred to the seed solution containing 50mg·L -1 In the TB fermentation medium of kanamycin, at 37°C, 160r·min -1 Cultivate under the conditions until the OD600 is 0.6, and add the final concentration of 0.25mmol L -1 IPTG, at 25°C, 160r·min -1 Cultivate under the condition for 12h, OD 600 is 1.5. Bacterial liquid at 4 ℃, 12000r min -1 Under these conditions, after centrifugation for 10 min, the lower layer of bacteria was collected, and 0.2 mol·L -1 Sodium phosphate buffer (pH 7.4) was used to resuspend the bacterial cells and collect the bacterial cells by centrifugation, and the above steps were repeated twice. Use an ultrasonic cell disruptor t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a saccharopolyspora horsoni sourced copper-containing amine oxidase capable of degrading biogenic amine and application thereof, and belongs to the technical field of molecular biology. According to the invention, one copper-containing amine oxidase with biogenic amine degradation capability is obtained by screening from saccharopolyspora hordei, the copper-containing amine oxidase can degrade phenylethylamine, histamine and tyramine within 24 hours, the degradation rates are respectively up to 54.27%, 57.15% and 51.58%, and the copper-containing amine oxidase is applicable to degradation of biogenic amine in yellow wine and soy sauce, and is beneficial to further improvement of the safety of fermented food.

Description

technical field [0001] The invention relates to a copper-containing amine oxidase derived from Saccharopolyspora hallowii that can degrade biogenic amines and an application thereof, belonging to the technical field of molecular biology. Background technique [0002] Biogenic amines are low-molecular-weight, nitrogen-containing organic bases mainly formed by the decarboxylation of amino acids. Biogenic amines are widely distributed in nature, can be metabolized by microorganisms, plants and animals, and can be ingested into the human body through food. An appropriate amount of biogenic amines has positive effects on the human body, such as improving human immunity, enhancing blood vessel activity, and regulating mental activity. However, when biogenic amines accumulate in the human body in large quantities, they can cause different toxic effects, such as headache, hypotension, heart palpitations and vomiting, and even life-threatening in severe cases. The biogenic amines i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/06C12N15/53C12N15/70C12N1/21A23L5/20A23L27/50C12H1/15C12R1/19
CPCC12N9/0022C12N15/70A23L5/25A23L27/50C12H1/003C12Y104/03006Y02A50/30
Inventor 毛健刘双平孙梦菲徐岳正周建弟
Owner JIANGNAN UNIV