Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Applications of suppressor of eytokine signaling 2

A signal transduction and cytokine technology, applied in the field of biomedicine, can solve the problem of low patient survival rate and high survival time

Inactive Publication Date: 2018-07-06
NANJING MEDICAL UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the surgical treatment of lung cancer is becoming more and more perfect, but the survival rate and survival time of patients are still not high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Applications of suppressor of eytokine signaling 2
  • Applications of suppressor of eytokine signaling 2
  • Applications of suppressor of eytokine signaling 2

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Correlation analysis was performed on the data of patient samples. First, the RNA of 92 lung cancer patients was extracted by the Trizol method, and the corresponding cDNA was obtained by reverse transcription. The mRNA level of SOCS2 (Primer F1: TTAAAAGAGGCACCAGAAGGAAC (SEQ ID NO.1); Primer R1: AGTCGATCAGATGAACCACACT (SEQ ID NO.2)), a total of lung cancer patient data were obtained in this experiment, and the expression difference analysis was performed, the results are shown in figure 1 , found that the expression level of SOCS2 in lung cancer was significantly lower than that in paracancerous tissues. The results suggest that SOCS2 plays a role in the occurrence and development of lung cancer.

Embodiment 2

[0036] Further analysis of the correlation between the expression level of SOCS2 and the pathological characteristics of the patients by analyzing the case data of 92 NSCLC patients showed that the expression level of SOCS2 was closely related to the size of the tumor (P=0.001), and the lymph node metastasis of the patient was closely related (P=0.001). <0.001) (Table 1). However, the expression level of SOCS2 has no correlation with the gender and age of NSCLC patients (Table 1).

[0037] Table 1

[0038]

[0039]

Embodiment 3

[0041] The DNA sequence of SOCS2 was cloned from cDNA by molecular cloning, and the DNA sequence of SOCS2 was amplified under the action of high-fidelity enzymes using the cDNA of huh7 cells as a template (primer F2: CCCTCGAGCTCGTTTTGGGATTCGCACTGA (SEQ ID NO.3) ; Primer R2: GGGGTACCCATAGCTGCATTCGGAGATA CT (SEQ ID NO.4)), and inserted into the expression vector of PXJ40-HA, the purpose of overexpressing the gene in the lung cancer cell line (A 549 / SPC-A1) was achieved by transfection.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses applications of suppressor of eytokine signaling 2 (SOCS2), and more specifically discloses applications of suppressor of eytokine signaling 2 as a treatment target in preparation of drugs used for treating lung cancer, and applications of suppressor of eytokine signaling 2 as a detection target in preparation of diagnostic reagents of lung cancer. It is found that lung cancer cell propagation is not influenced by SOCS2, it is possible to inhibit migration and invasion capacity of lung cancer cells through inhibition of tumor EMT process, wherein tumor migration and invasion capacity are closely related with tumor course.

Description

technical field [0001] The discovery belongs to the field of biomedicine, and specifically relates to the application of cytokine signal transduction inhibitor 2. Background technique [0002] Lung cancer occurs in the lung tissue, originating from the bronchial mucosa and glands. There are two main types, small cell lung cancer and non-small cell lung cancer. The main clinical symptoms are cough, hemoptysis, wheezing, chest tightness, shortness of breath, weight loss, and fever. Lung cancer is one of the most common malignant tumors. According to statistics from the International Agency for Research on Cancer (IARC), 1.607 million people developed lung cancer in 2008, and the death toll reached 1.375 million. In recent years, due to increasingly serious air pollution, massive tobacco consumption, population aging and other factors, the incidence of lung cancer is increasing day by day, and it has become the cancer with the highest mortality rate in the world. [0003] Lu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6886A61K45/00A61P35/00
CPCA61K45/00C12Q1/6886C12Q2600/158
Inventor 王倩周悦张志蕾王宁
Owner NANJING MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products