Applications of suppressor of eytokine signaling 2
A signal transduction and cytokine technology, applied in the field of biomedicine, can solve the problem of low patient survival rate and high survival time
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Correlation analysis was performed on the data of patient samples. First, the RNA of 92 lung cancer patients was extracted by the Trizol method, and the corresponding cDNA was obtained by reverse transcription. The mRNA level of SOCS2 (Primer F1: TTAAAAGAGGCACCAGAAGGAAC (SEQ ID NO.1); Primer R1: AGTCGATCAGATGAACCACACT (SEQ ID NO.2)), a total of lung cancer patient data were obtained in this experiment, and the expression difference analysis was performed, the results are shown in figure 1 , found that the expression level of SOCS2 in lung cancer was significantly lower than that in paracancerous tissues. The results suggest that SOCS2 plays a role in the occurrence and development of lung cancer.
Embodiment 2
[0036] Further analysis of the correlation between the expression level of SOCS2 and the pathological characteristics of the patients by analyzing the case data of 92 NSCLC patients showed that the expression level of SOCS2 was closely related to the size of the tumor (P=0.001), and the lymph node metastasis of the patient was closely related (P=0.001). <0.001) (Table 1). However, the expression level of SOCS2 has no correlation with the gender and age of NSCLC patients (Table 1).
[0037] Table 1
[0038]
[0039]
Embodiment 3
[0041] The DNA sequence of SOCS2 was cloned from cDNA by molecular cloning, and the DNA sequence of SOCS2 was amplified under the action of high-fidelity enzymes using the cDNA of huh7 cells as a template (primer F2: CCCTCGAGCTCGTTTTGGGATTCGCACTGA (SEQ ID NO.3) ; Primer R2: GGGGTACCCATAGCTGCATTCGGAGATA CT (SEQ ID NO.4)), and inserted into the expression vector of PXJ40-HA, the purpose of overexpressing the gene in the lung cancer cell line (A 549 / SPC-A1) was achieved by transfection.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



