Unlock instant, AI-driven research and patent intelligence for your innovation.

bcr-abl1 fusion gene e14a2 subtype plasmid candidate reference material and its preparation method and use

A BCR-ABL1 and fusion gene technology, applied in the field of BCR-ABL1 fusion gene e14a2 subtype plasmid candidate reference materials, can solve the problem that there is no BCR-ABL1 fusion gene

Active Publication Date: 2020-09-01
AFFILIATED HOSPITAL OF NANTONG UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no candidate reference material for the e14a2 subtype plasmid of the BCR-ABL1 fusion gene in my country

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • bcr-abl1 fusion gene e14a2 subtype plasmid candidate reference material and its preparation method and use
  • bcr-abl1 fusion gene e14a2 subtype plasmid candidate reference material and its preparation method and use
  • bcr-abl1 fusion gene e14a2 subtype plasmid candidate reference material and its preparation method and use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0048] A plasmid candidate reference material of the e14a2 subtype of the BCR-ABL1 fusion gene, the nucleotide sequence of which is:

[0049] tgtcggagcaggagtcactgctgctgcttatgtctcccagcatggccttcagggtgcacagccgcaacggcaagagttacacgttcctgatctcctctgactatgagcgtgcagagtggagggagaacatccgggagcagcagaagaagtgtttcagaagcttctccctgacatccgtggagctgcagatgctgaccaactcgtgtgtgaaactccagactgtccacagcattccgctgaccatcaataaggaagatgatgagtctccggggctctatgggtttctgaatgtcatcgtccactcagccactggatttaagcagagttcaaaagcccttcagcggccagtagcatctgactttgagcctcagggtctgagtgaagccgctcgttggaactccaaggaaaaccttctcgctggacccagtgaaaatgaccccaaccttttcgttgcactgtatgattttgtggccagtggagataacactctaagcataactaaaggtgaaaagctccgggtcttaggctataatcacaatggggaatggtgtgaagcccaaaccaaaaatggccaaggctgggtcccaagcaactacatcacgccagtcaacagtctggagaaacactcctggtaccatgggcctgtgtcccgcaatgccgctgagtatctgctgagcagcgggatcaatggcagcttcttggtgcgtgagagtgagagcagtcctggccagaggtccatctcgctgagatacgaagggagggtgtaccattacaggatcaacactgcttctgatggcaagctctacgtctcctccgagagccgcttcaacaccctggccgagttggttcatc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a BCR-ABL1 fusion gene e14a2 subtype plasmid candidate reference substance and a preparation method and a purpose thereof. When the candidate reference substance is prepared, aprimer is designed, a molecule clone technology is employed for constructing a BCR-ABL1 fusion gene e14a2 subtype-containing recombinant plasmid candidate reference substance; through enzyme electrophoresis and sequencing verification, real-time fluorescence quantification PCR performs uniformity and stability evaluation, and the measurement uncertainty is determined. The uniform and stable BCR-ABL1 fusion gene e14a2 subtype plasmid candidate reference substance is prepared, can be used for calibration of a chronic granulocytic leukemia BCR-ABL1 fusion gene e14a2 subtype fluorescence quantification PCR related molecule diagnostic reagent manufacturer product, and can be used for evaluating the performance of a clinical laboratory real-time fluorescence quantification PCR detection method,so that the detection results of different clinical laboratories have comparability, and the clinical examination standardization can be promoted.

Description

technical field [0001] The invention relates to a BCR-ABL1 fusion gene e14a2 subtype plasmid candidate reference material and its preparation method and application. Background technique [0002] The characteristic molecular markers of chronic myeloid leukemia (CML) are composed of Abelson murine leukemia viral oncogene homolog1 (ABL1) and break point cluster region (break point cluster region, BCR-ABL1 fusion gene formed by BCR) translocation [1] . Different break sites of the BCR gene produce multiple BCR-ABL1 subtypes, the most common of which is the e14a2 subtype, which is formed by breaking the e14 exon of BCR and the a2 exon of ABL1 [2] . In recent years, the application of molecular biology techniques to target detection of BCR-ABL1 provides a basis for the diagnosis, therapeutic efficacy and dynamic monitoring of minimal residual lesions in CML. [0003] Real-time Quantitative Polymerase Chain Reaction (RQ-PCR) is a common method for detecting the fusion gene BCR...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6886C12Q1/6806C12Q1/6851C12N15/63
CPCC12N15/63C12Q1/6806C12Q1/6851C12Q1/6886C12Q2600/156C12Q2600/166C12Q2531/113C12Q2545/113
Inventor 景蓉蓉王惠民于书平崔明袁丹丹
Owner AFFILIATED HOSPITAL OF NANTONG UNIV