Application of mir-1307 or its precursor in the preparation of a composition for preventing and/or treating foot-and-mouth disease virus infection
A technology of 1.mir-1307, foot-and-mouth disease virus, applied in the direction of antiviral agents, medical preparations containing active ingredients, pharmaceutical formulations, etc., can solve the problems of delayed immune response, short immune protection time, and long vaccine development cycle.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Example 1: Identification of miRNAs differentially regulated by foot-and-mouth disease virus infection
[0032] The general identification process is as follows: firstly collect PK-15 cell control samples and samples 2h after FMD virus infection, and identify differentially expressed miRNAs by Affymetrix miRNA chip. Chip hybridization and data analysis were entrusted to Beijing Boao Jingdian Biotechnology Co., Ltd. For the differentially expressed miRNAs identified, their expression levels were verified by RT-qPCR, and miR-1307 was finally identified, whose expression level was significantly induced by foot-and-mouth disease virus infection. Wherein, miR-1307 refers to miRNA comprising the sequence shown in SEQ ID NO: 1 or a homologous sequence, wherein, SEQ ID NO: 1: ACUCGGCGUGGCGUCGGUCGUG. Various sources of miR-1307 are known in the art, such as porcine, bovine, sheep, etc., and these homologous sequences are all included in the miR-1307 of the present invention. T...
Embodiment 2
[0041] Embodiment 2: Study the impact of miR-1307 mimics on the replication of foot-and-mouth disease virus
[0042] In order to test whether miR-1307 can affect the replication of foot-and-mouth disease virus, we commissioned Shanghai Jima Pharmaceutical Technology Co., Ltd. to synthesize miR-1307 mimics (mimics) and control mimics (NC). The sequence of the mimics is SEQ ID NO: 4 : ACUCGGCGUGGCGUCGGUCGUG, the sequence of NC is SEQ ID NO: 5: UUCUCCGAACGUGUCACGUTT. PK-15 cells were inoculated 36 hours after transfection with NC or mimics (the specific steps were the same as above), samples were collected at different time points after virus infection, and the relative expression of viral RNA was detected by RT-qPCR.
[0043] The detailed steps of Mimics transfection and virus infection are as follows:
[0044] Cell preparation: When PK-15 cells are cultured in a six-well plate to about 80% confluence, aspirate the medium, add 2mL PBS to wash the cells twice, aspirate the PBS, ...
Embodiment 3
[0054] Example 3: Effect of overexpressing miR-1307 on the replication of foot-and-mouth disease virus
[0055] Firstly, a miR-1307 overexpressed cell line was constructed based on PK-15, and then the control cell line (NC) and the miR-1307 overexpressed cell line were infected with foot-and-mouth disease virus. Finally, the relative expression of viral RNA and the protein expression of VP1 The effect of miR-1307 overexpression on the replication of FMD virus was evaluated in terms of the level and virus titer.
[0056] Construction of miR-1307 overexpression cell lines:
[0057] In order to further confirm the inhibitory effect of miR-1307 on the replication of foot-and-mouth disease virus, we entrusted Shanghai Jima Pharmaceutical Technology Co., Ltd. to construct a plasmid for miR-1307 overexpression (pmiR-1307, the target sequence is SEQ ID NO: 9: ACTCGGCGTGGCGTCGGTCGTG) and negative Control plasmid (NC, target sequence is SEQ ID NO: 10: AAATGTACTGCGCGTGGAGAC). The const...
PUM
| Property | Measurement | Unit |
|---|---|---|
| diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More