Check patentability & draft patents in minutes with Patsnap Eureka AI!

Circular RNA circ-GPC3 and its detection reagents and applications

A circular and kit-based technology, applied in DNA/RNA fragments, recombinant DNA technology, microbial measurement/inspection, etc., can solve problems such as acircular RNAcirc-GPC3 research

Active Publication Date: 2021-10-19
GUANGZHOU FOREVERGEN BIOTECH CO LTD
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, there is no research on circular RNA circ-GPC3 in the prior art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Circular RNA circ-GPC3 and its detection reagents and applications
  • Circular RNA circ-GPC3 and its detection reagents and applications
  • Circular RNA circ-GPC3 and its detection reagents and applications

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] An embodiment of the circular RNA circ-GPC3 of the present invention, the cDNA sequence corresponding to the circular RNA circ-GPC3 in this embodiment is shown in SEQ ID NO: 1, and the circular RNA circ-GPC3 is composed of the GPC3 parent gene The third independent exon is reverse spliced ​​and circularized, and the length of the mature circ-GPC3 sequence is 695nt. The molecular localization and formation pattern of the circular RNA circ-GPC3 are shown in figure 1 shown.

Embodiment 2

[0028] In this example, PCR amplification primers were designed and the objective presence of the circular RNA circ-GPC3 described in Example 1 in liver cells was identified. The method for identification and identification in this embodiment includes the following steps: 1. Trizol method to extract total RNA in liver cells; 2. Use DNase to remove residual genomic DNA in the extracted RNA: 3. Reverse transcribe RNA into cDNA; 4. Design Reverse amplification primers were used for PCR amplification. After the PCR products were subjected to nucleic acid gel electrophoresis, the target bands were recovered by tapping the gel, and then the interface of the objective existence of circular RNA circ-GPC3 was verified by sanger DNA sequencing. In this example, the specific method for identifying and identifying the objective existence of the circular RNA circ-GPC3 described in Example 1 in liver cells is as follows:

[0029] 1. RNA extraction (Trizol method)

[0030] (1) Take about 1 ...

Embodiment 3

[0049] In this example, normal liver cell line LO2 and liver cancer cell lines Hep3B, HepG2, and Huh7 were selected, and fluorescence quantitative PCR was used to detect the expression of circular circ-GPC3 molecules in liver cells.

[0050] In this example, a fluorescent quantitative PCRtaqman probe is designed according to the mature sequence of the circular RNA circ-GPC3 described in Example 1; the sequence of the probe is:

[0051] 5'FAM-CCTAGTGGTGGTCAGCTTTCCTG-TAMRA 3' (as shown in SEQ ID NO: 4);

[0052] The matching primers are reverse PCR primers F1 / R1 for identifying and identifying circular RNA; see Example 2 for the sequence,

[0053] F1: 5'GAACGTACTGCTTGGTCTCT3' (shown in SEQ ID NO: 2),

[0054] R1: 5'TTCTTGGCATGGCGAACAAC 3' (shown in SEQ ID NO:3). The size of the amplified circular RNA circ-GPC3 circularization interface region sequence is 116bp.

[0055] The method for detecting the expression of circular circ-GPC3 molecules in each cell by fluorescent quantit...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a circular RNA circ-GPC3 and its detection reagent and application, belonging to the field of biotechnology. The cDNA sequence corresponding to the circular RNA circ-GPC3 of the present invention is shown in SEQ ID NO: 1, and the circular RNA circ-GPC3 is produced by reverse splicing and circularization of the third independent exon of the GPC3 parent gene; the present invention The detection primers of the inventive circular RNA circ-GPC3 are shown in SEQ ID NO: 2 and SEQ ID NO: 3; the detection probes of the circular RNA circ-GPC3 of the present invention are shown in SEQ ID NO: 4, and the probe The 5' end is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group. The present invention provides a new circular RNA molecule—circular RNA circ-GPC3, and uses the circular RNA circ-GPC3 as a molecular marker to diagnose liver cancer. The present invention also designs fluorescent quantitative detection primers and taqman probes for circular RNA circ-GPC3 molecules. The probes and primers can well detect the expression of circ-GPC3 in organisms, and can provide a diagnosis based on liver cancer. Protocol for circular RNA detection.

Description

technical field [0001] The invention relates to a circular RNA circ-GPC3 and its detection reagent and application, in particular to a circular RNA circ-GPC3, its detection primers and probes and the application of the circular RNA circ-GPC3 in the diagnosis of liver cancer, belonging to field of biotechnology. Background technique [0002] Circular RNA (circRNA) is a type of closed circular RNA molecule that exists in organisms, has a variety of biological characteristics, and exists in large quantities objectively. Circular RNA is a novel nucleic acid molecule produced by reverse splicing of genomic DNA after transcription and processing. The specific functional mechanism of circular RNA is not yet clear, but circular RNA can regulate gene expression at multiple levels in organisms, for example: circular RNA can absorb miRNA through the action of sponge, and regulate gene expression after transcription; Binding proteins regulate gene transcription; circRNAs can combine w...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12N15/11C12Q1/6886
CPCC12N15/113C12N2310/10C12Q1/6886C12Q2600/158C12Q2600/178
Inventor 张茂雷赖炳权罗景燕赵发兰
Owner GUANGZHOU FOREVERGEN BIOTECH CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More