NY-ESO-1-targeting T cell receptor and uses thereof

A technology of NY-ESO-1 TCR and cell receptors, which is applied in the field of T cell receptors targeting NY-ESO-1, and can solve problems affecting the killing function of T cells

Inactive Publication Date: 2018-08-28
HRAIN BIOTECHNOLOGY CO LTD
View PDF5 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, regulatory T cells, myeloid-derived suppressor cells, and some cytokines will all affect the input of genetically modified T cells, thereby affecting the killing function of T cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • NY-ESO-1-targeting T cell receptor and uses thereof
  • NY-ESO-1-targeting T cell receptor and uses thereof
  • NY-ESO-1-targeting T cell receptor and uses thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0066] Example 1: Determination of NY-ESO-1 TCR gene sequence

[0067] The sequence information of human NY-ESO-1 TCR α chain, P2A, NY-ESO-1 TCR β chain gene sequence information was searched from the NCBI website database, and these sequences were codon optimized on the website http: / / sg.idtdna.com / site, It is guaranteed that it is more suitable for human cell expression under the condition that the encoded amino acid sequence remains unchanged.

[0068] See (SEQUUNCE ID NO.1-2) for each amino acid and gene sequence information.

[0069] Ligate the above sequence according to the human NY-ESO-1 TCRα chain, P2A, and NY-ESO-1 TCRβ chain in sequence, and introduce enzyme cutting sites at the sequence junction to form a complete NY-ESO-1 TCR gene sequence information .

Embodiment 2

[0070] Embodiment 2: the construction of the viral vector comprising the nucleic acid sequence of TCR molecule

[0071] The nucleotide sequence of the TCR molecule prepared in Example 1 was double digested with NotI (NEB) and EcoRI (NEB), connected and inserted into the NotI-EcoRI site of the retroviral RV vector through T4 ligase (NEB), and transformed into When the competent E.coli (DH5α) was obtained, the recombinant plasmid was sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing, and the sequencing result was compared with the fitted NY-ESO-1TCR sequence to verify whether the sequence was correct. The sequencing primers are:

[0072] Sense sequence: AGCATCGTTCTGTGTTGTCTC

[0073] Antisense sequence: TGTTTGTCTTGTGGCAATACAC

[0074] After the sequencing was correct, the plasmid was extracted and purified using the plasmid purification kit from Qiagen, and the purified plasmid was transfected into 293T cells by the plasmid calcium phosphate method for retrovirus ...

Embodiment 3

[0076] Example 3: Retroviral Packaging

[0077] 1. On the first day, the 293T cells should be less than 20 passages and not overgrown. Take 0.6×10 6 Cells / ml plated, add 10ml DMEM medium to a 10cm dish, mix the cells well, and culture overnight at 37 degrees;

[0078] 2. On the second day, the 293T cell confluency reaches about 90% for transfection (usually about 14-18 hours after plating); prepare the plasmid complex, the amount of various plasmids is 12.5ug for Retro backbone (MSCV), and 12.5ug for Gag-pol 10ug, VSVg is 6.25ug, CaCl 2 250ul,H2 O is 1ml and the total volume is 1.25ml; add HBS equal to the volume of the plasmid complex in another tube, and vortex for 20 seconds while adding the plasmid complex. Gently add the mixture to the 293T dish along the side, incubate at 37 degrees for 4 hours, remove the medium, wash with PBS, and re-add the preheated fresh medium;

[0079] 3. Day 4: 48 hours after transfection, collect the supernatant and filter it with a 0.45um ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a NY-ESO-1-targeting T cell receptor and uses thereof, wherein the NY-ESO-1-targeting T cell receptor is formed by linking a NY-ESO-1 TCR[alpha] chain, P2A and a NY-ESO-1 TCR[beat] chain in series. According to the present invention, the T cell receptor is used for modifying human T lymphocytes, and the modified T cells (TCR-T cells) can be used for the treatment of HLA-A2+NY-ESO-1 positive tumors; and the prepared NY-ESO-1 TCR-T cells have strong functions on specific tumor cells (U266 and T2-NY-ESO-1), has high CD107a expression and high IFN[gamma] secretion, and achieves the killing efficiency of 80% in the case of an effect-to-target ratio of 5:1.

Description

technical field [0001] The invention belongs to the field of T cell receptors, and specifically relates to T cell receptors targeting NY-ESO-1 and uses thereof. Background technique [0002] In recent years, great progress has been made in the screening of tumor-specific antigens, and a large number of tumor-associated antigens and tumor-specific antigens have been discovered. The cancer-testis antigen (CT) antigen was first discovered by Professor Boon and his colleagues in Belgium in 1991. CT is the largest number of tumor-specific antigens identified so far. They have the following common characteristics: general It is not expressed in normal tissues; it is expressed in different intensities in various tumors such as liver cancer, malignant melanoma, and lung cancer; the coding gene is located on the X chromosome. Due to the above characteristics, CT antigens are considered as tumor-specific shared antigens. [0003] CT antigens include melanoma antigen (MAGE) family, S...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K14/705C07K19/00C12N15/12C12N15/62C12N15/867C12N7/01C12N5/10A61P35/00
CPCA61K35/17C07K14/7051C07K2319/00C12N7/00C12N15/86C12N2740/10021C12N2740/10043
Inventor黄飞金涛王海鹰何凤史子啸
OwnerHRAIN BIOTECHNOLOGY CO LTD