Method for preparing bio-based nylon-54 precursor by using co-fermentation of genetically engineered bacteria
A technology of bio-based nylon and genetically engineered bacteria, applied in the field of preparing bio-based nylon-54 precursor, can solve problems such as poor effect, reduce carbon loss and greenhouse gas emissions, improve process efficiency and process yield, The effect of shortening the process steps
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Example Embodiment
[0032] Example 1 Construction of recombinant plasmid
[0033] Using the E. coli genome as a template, PCR amplification was performed with primers at both ends of the lysine decarboxylase gene cadA gene; the obtained cadA fragment was cloned into the NdeI and KpnI sites of the vector pETDuet-1 to obtain the recombinant plasmid pETDuet-CadA.
[0034] Among them, PCR conditions are: reaction system 50μL, specific components: genome template, 1μL; upstream primer, 2μL; downstream primer, 2μL; enzyme, 1μL; dNTPs, 4μL; 5x buffer, 10μL; ddH 2 O, 30 μL. The amplification procedure is: pre-denaturation at 95°C for 5 minutes; denaturation at 95°C for 30 seconds, annealing at 55-57°C for 30 seconds, extension at 72°C for 75s, cycling 25-30 times; extension at 72°C for 10 minutes.
[0035] Among them, when PCR amplification is performed with primers at both ends of the lysine decarboxylase gene cadA, the upstream primer is GGAATTCCATATGAACGTTATTGCAATATTG, and the downstream primer is GGGGTACCTT...
Example Embodiment
[0036] Example 2 Construction of recombinant plasmid
[0037] Using the plasmid pETDuet-CadA obtained in Example 1 as the template, the upstream primer CadA-4A-F and the downstream primer CadA-4A-R were used for PCR amplification to obtain the fragment CadA-4A; wherein the PCR conditions were: reaction system 50μL, the specific components are: genome template, 1μL; upstream primer, 2μL; downstream primer, 2μL; enzyme, 1μL; dNTPs, 4μL; 5x buffer, 10μL; ddH 2 O, 30 μL. The amplification procedure is: 95°C pre-denaturation for 5 minutes; 95°C denaturation for 30s, 55-57°C annealing for 30s, 72°C extension for 75s, 25 to 30 cycles; 72°C extension for 10 minutes;
[0038] Using plasmid pCDFDuet-1 as a template, using the upstream primer Fuse-pCDF-F and downstream primer Fuse-pCDF-R for PCR amplification, the fragment CDF-4A was obtained; the PCR conditions were: reaction system 50μL, and the specific components were :Genome template, 1μL; upstream primer, 2μL; downstream primer, 2μL; e...
Example Embodiment
[0044] Example 3 Preparation of host cell competence
[0045] Use LB medium to cultivate E.coli AFP111 to OD at 37°C under aerobic conditions 600 = 0.4-0.6, prepared into a chemical conversion competent.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More