Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for preparing bio-based nylon-54 precursor by using co-fermentation of genetically engineered bacteria

A technology of bio-based nylon and genetically engineered bacteria, applied in the field of preparing bio-based nylon-54 precursor, can solve problems such as poor effect, reduce carbon loss and greenhouse gas emissions, improve process efficiency and process yield, The effect of shortening the process steps

Active Publication Date: 2018-09-14
NANJING UNIV OF TECH
View PDF4 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The technical problem to be solved in the present invention is to provide a method for preparing bio-based nylon-54 precursor—pentame

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0032] Example 1 Construction of recombinant plasmid

[0033] Using the E. coli genome as a template, PCR amplification was performed with primers at both ends of the lysine decarboxylase gene cadA gene; the obtained cadA fragment was cloned into the NdeI and KpnI sites of the vector pETDuet-1 to obtain the recombinant plasmid pETDuet-CadA.

[0034] Among them, PCR conditions are: reaction system 50μL, specific components: genome template, 1μL; upstream primer, 2μL; downstream primer, 2μL; enzyme, 1μL; dNTPs, 4μL; 5x buffer, 10μL; ddH 2 O, 30 μL. The amplification procedure is: pre-denaturation at 95°C for 5 minutes; denaturation at 95°C for 30 seconds, annealing at 55-57°C for 30 seconds, extension at 72°C for 75s, cycling 25-30 times; extension at 72°C for 10 minutes.

[0035] Among them, when PCR amplification is performed with primers at both ends of the lysine decarboxylase gene cadA, the upstream primer is GGAATTCCATATGAACGTTATTGCAATATTG, and the downstream primer is GGGGTACCTT...

Example Embodiment

[0036] Example 2 Construction of recombinant plasmid

[0037] Using the plasmid pETDuet-CadA obtained in Example 1 as the template, the upstream primer CadA-4A-F and the downstream primer CadA-4A-R were used for PCR amplification to obtain the fragment CadA-4A; wherein the PCR conditions were: reaction system 50μL, the specific components are: genome template, 1μL; upstream primer, 2μL; downstream primer, 2μL; enzyme, 1μL; dNTPs, 4μL; 5x buffer, 10μL; ddH 2 O, 30 μL. The amplification procedure is: 95°C pre-denaturation for 5 minutes; 95°C denaturation for 30s, 55-57°C annealing for 30s, 72°C extension for 75s, 25 to 30 cycles; 72°C extension for 10 minutes;

[0038] Using plasmid pCDFDuet-1 as a template, using the upstream primer Fuse-pCDF-F and downstream primer Fuse-pCDF-R for PCR amplification, the fragment CDF-4A was obtained; the PCR conditions were: reaction system 50μL, and the specific components were :Genome template, 1μL; upstream primer, 2μL; downstream primer, 2μL; e...

Example Embodiment

[0044] Example 3 Preparation of host cell competence

[0045] Use LB medium to cultivate E.coli AFP111 to OD at 37°C under aerobic conditions 600 = 0.4-0.6, prepared into a chemical conversion competent.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for preparing bio-based nylon-54 precursor-pentylenediamine butanediate by using the co-fermentation of genetically engineered bacteria. Lysine decarboxylase is over-expressed in succinic acid generation strain, the lysine is added to perform the decarboxylation in the fermentation process of succinic acid, two decarboxylation products, i.e., pentamethylene diamineand CO2 are respectively used for synthesizing a regulating agent for the system pH and succinic acid, the co-fermentation production of succinic acid and the fixation of CO2 are realized, and pentylenediamine butanediate in a fermentation solution can be used as a precursor to be further used for polymerizing the bio-based nylon-54. Compared with the existing preparation method of the nylon-54,the method is simple in process, low in cost, safe and controllable in process, environmentally friendly, high in application value, and good in economical performance.

Description

technical field [0001] The invention belongs to the field of microbial fermentation, and in particular relates to a method for preparing bio-based nylon-54 precursor by co-fermentation with genetically engineered bacteria. Background technique [0002] At present, the global nylon (PA) output is about 6 million tons, and it is growing at a rate of 5.4% per year, of which 38% is used as fiber, 46% is injection molding, 14% is extrusion molding, and the remaining deep-processed products account for about 2%. , of which China's consumption accounts for 30% of global nylon production. The global nylon market is expected to reach $43.7 billion by 2020. However, the monomers currently used to produce nylon are still obtained through chemical processing and are derivatives of fossil resources. With the depletion of fossil resources and the strengthening of people's awareness of environmental protection, more attention has been paid to environmentally friendly materials based on b...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/70C12N15/57C12P13/02C12R1/19
CPCC12N9/48C12N15/70C12P13/02C12Y401/01018
Inventor 陈可泉王璟许晟程琪田威龙魏国光欧阳平凯
Owner NANJING UNIV OF TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com