Unlock instant, AI-driven research and patent intelligence for your innovation.

Liquid biopolymer, use thereof, and preparation method

A technology of biopolymers and compositions, applied in the direction of biochemical equipment and methods, enzymes, transferases, etc., to achieve the effect of preventing adhesion between tissues and excellent adhesion properties

Inactive Publication Date: 2018-09-28
LG CHEM LTD
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Contents of

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Liquid biopolymer, use thereof, and preparation method
  • Liquid biopolymer, use thereof, and preparation method
  • Liquid biopolymer, use thereof, and preparation method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0113] Example 1. Preparation of recombinant carrier for the preparation of 4-hydroxybutyrate-2-hydroxybutyrate copolymer

[0114] 1-1. Preparation of pPs619C1310-CPPCT540 recombinant vector

[0115] A mutant of the propionyl-CoA transferase (CP-PCT) gene derived from Clostridium propionicum was used as the propionyl-CoA transferase gene (pct), and a mutant derived from Pseudomonas MBEL 6-19 (KCTC 11027BP) mutant of the PHA synthase gene was used as the PHA synthase gene. The vector used was pBluescript I (Stratagene Co., USA).

[0116] First, the total DNA of Pseudomonas MBEL 6-19 (KCTC 11027BP) was extracted to isolate the PHA synthase (phaC1 Ps6-19 )Gene. Based on phaC1 Ps6-19 Gene sequence (SEQ ID NO: 3), preparation of primers [5'-GAG AGA CAATCA AAT CAT GAG TAA CAA GAG TAA CG-3' (SEQ ID NO: 5), 5'-CAC TCA TGC AAG CGT CACCGT TCG TGC ACG TAC-3' (SEQ ID NO: 6)]. PCR was performed using the extracted whole DNA as a template. Electrophoresis was performed on the obt...

Embodiment 2

[0124] Example 2. Preparation of Escherichia coli XL1-Blue variant with ldhA gene knockout

[0125] For the production of lactic acid-free polymers based on E. coli XL1-Blue (Stratagene, USA), D-lactate dehydrogenase (LdhA), which is involved in lactic acid production during the metabolism of E. coli, was knocked out from genomic DNA. Genetic deletions were performed using the well-known red recombination method. Oligomers for deletion of ldhA were synthesized to have the sequences of SEQ ID NO: 31 (5'-atcagcgtacccgtgatgctaacttctctctggaaggtctgaccggctttaattaaccctcactaaagggcg-3') and SEQ ID NO: 32 (5'-atcagcgtacccgtgatgctaacttctctctggaaggtctgaccggctggttaattaa'accctggcgact).

Embodiment 3

[0126] Preparation of embodiment 3.4-hydroxybutyrate-2-hydroxybutyrate copolymer

[0127] The recombinant vector prepared in Example 1 was transformed into the Escherichia coli XL1-BlueΔldhA with ldhA gene knockout prepared in Example 2 by electroporation to obtain recombinant Escherichia coli XL1-BlueΔldhA. Flask culture was performed to produce the above-mentioned terpolymer using the recombinant E. coli . First, for seed culture, recombinant Escherichia coli was cultured in 3 mL of LB medium containing 100 mg / L ampicillin and 20 mg / L kanamycin [Bacto TM Triptone (BD) 10g / L, Bacto TM Yeast extract (BD) 5g / L, NaCL (amresco) 10g / L] for 12 hours. For the main culture, inoculate 1ml of seed culture into cells supplemented with 1g / L 4-hydroxybutyrate (4-HB), 1g / L 2-hydroxybutyrate (2-HB), 100mg / L ampicillin, 20mg 100ml MR medium (glucose 10g, KH 2 PO 4 6.67g, (NH 4 ) 2 HPO 4 4g, MgSO 4 ·7H 2 O0.8g, citric acid 0.8g and trace metal solution 5mL / 1L; here, trace metal s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A biopolymer, which exists in a liquid phase at room temperature, a use thereof, and a preparation method therefor are provided.

Description

technical field [0001] Cross References to Related Applications [0002] This application claims the benefit of priority from Korean Patent Application No. 10-2016-0037218 filed on March 28, 2016, the entire disclosure of which is incorporated herein by reference. [0003] The present invention provides a polyhydroxyalkanoate (polyhydroxyalkanoate: PHA) biopolymer existing in a liquid phase at room temperature, its use and its preparation method. Background technique [0004] Biopolymers are polymer plastics produced by using biomass as a raw material. Biopolymer is a generic term not only for plastics consisting only of biomass-based components, but also for mixtures containing petrochemical-based plastics. Biopolymers are environmentally friendly materials whose main components are plastics made from plants and microorganisms, which can be easily decomposed and converted into a form that can be absorbed by living organisms. [0005] Polyhydroxyalkanoate (PHA), a typica...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C08G63/91C08L67/02C12P7/62C12N9/10
CPCC12P7/625C12N9/13C12Y208/03001C12Y101/01027C12N9/0006C12N9/1029C12R2001/38C08G63/06C08G63/912C08L67/02C12N9/1025C08L2201/06C07K14/21C08G2230/00C09D167/04
Inventor 金在亨姜东均金喆雄曹泳贤吴诚浚李政圭许仁荣
Owner LG CHEM LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com