Nucleic acid aptamer for recognizing liver cancer cells, and screening method and purpose thereof
A nucleic acid aptamer, liver cancer cell technology, applied in the field of biomedicine, can solve problems such as inability to cure, lack of effective therapeutic drugs, etc., and achieve excellent stability, high affinity, specificity, and good reproducibility.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0043] In order to describe the technical content, structural features, achieved goals and effects of the present invention in detail, the following will be described in detail in conjunction with the embodiments and accompanying drawings.
[0044] An embodiment of the present invention is: a nucleic acid aptamer for recognizing liver cancer cells and a screening method thereof, wherein the nucleotide sequence of the nucleic acid aptamer includes AGGAGGTTAGGGGTGGGTGGGTGGT, and the screening method comprises the following steps:
[0045] 1. Initial DNA library (i.e. primary library) preparation:
[0046] Design and synthesize the two ends to contain 19 nucleotides (primers), and the middle includes the nucleic acid sequence random nucleic acid library and the amplification primer of 25 nucleotide random sequences, specifically as follows:
[0047] ACC TTG GCT GTC GTG TTG T (as shown in Seq ID No.2)-25nt-A GGT CAG TGG TCAGAG CGT (as shown in Seq ID No.3)
[0048] 5' primer: ACC T...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap