Supercharge Your Innovation With Domain-Expert AI Agents!

Nucleic acid aptamer for recognizing liver cancer cells, and screening method and purpose thereof

A nucleic acid aptamer, liver cancer cell technology, applied in the field of biomedicine, can solve problems such as inability to cure, lack of effective therapeutic drugs, etc., and achieve excellent stability, high affinity, specificity, and good reproducibility.

Inactive Publication Date: 2018-11-23
THE FIFTH AFFILIATED HOSPITAL SUN YAT SEN UNIV
View PDF4 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the clinical treatment plan, although surgical treatment can cure liver cancer, it is limited to a small number of patients. For most patients, due to factors such as large lesions or high postoperative recurrence rate, they cannot be cured.
Therefore, chemotherapy is still the main treatment method, but the current chemotherapy of liver cancer still lacks effective therapeutic drugs to ensure the chemotherapy effect of liver cancer. It is urgent to further develop new therapeutic drugs or methods in combination with the research on the pathogenesis of liver cancer.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid aptamer for recognizing liver cancer cells, and screening method and purpose thereof
  • Nucleic acid aptamer for recognizing liver cancer cells, and screening method and purpose thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0043] In order to describe the technical content, structural features, achieved goals and effects of the present invention in detail, the following will be described in detail in conjunction with the embodiments and accompanying drawings.

[0044] An embodiment of the present invention is: a nucleic acid aptamer for recognizing liver cancer cells and a screening method thereof, wherein the nucleotide sequence of the nucleic acid aptamer includes AGGAGGTTAGGGGTGGGTGGGTGGT, and the screening method comprises the following steps:

[0045] 1. Initial DNA library (i.e. primary library) preparation:

[0046] Design and synthesize the two ends to contain 19 nucleotides (primers), and the middle includes the nucleic acid sequence random nucleic acid library and the amplification primer of 25 nucleotide random sequences, specifically as follows:

[0047] ACC TTG GCT GTC GTG TTG T (as shown in Seq ID No.2)-25nt-A GGT CAG TGG TCAGAG CGT (as shown in Seq ID No.3)

[0048] 5' primer: ACC T...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a nucleic acid aptamer for recognizing liver cancer cells, and a screening method and a purpose thereof. The nucleotide sequence of the nucleic acid aptamer comprises the feature sequence part shown as Seq ID No.1. The purpose comprises the purpose of the nucleic acid aptamer to the design and preparation of anti-liver-cancer medicine or detection reagents. The detection reagents comprise enzyme-linked immunosorbent assay, immunoradiometric assay or fluorescence method. The invention also comprises a target preparation and a medicine composition. The target preparationcomprises the nucleic acid aptamer and a medically acceptable carrier or a shaping agent. The medicine composition comprises the nucleic acid aptamer, at least one antitumor medicine and a medically acceptable carrier. Compared with the prior art, the nucleic acid aptamer can be used for specifically recognizing the liver cancer cells; good application prospects are realized.

Description

technical field [0001] The present invention relates to the field of biomedicine, in particular to a nucleic acid aptamer for recognizing liver cancer cells and its screening method and application. Background technique [0002] Primary liver cancer is one of the most common and most malignant tumors in the world. Therefore, research on the treatment of liver cancer is urgent. In the clinical treatment plan, although surgical treatment can cure liver cancer, it is limited to a small number of patients. For most patients, due to factors such as large lesions or high postoperative recurrence rate, they cannot be cured. Therefore, chemotherapy is still the main treatment method, but the current chemotherapy of liver cancer still lacks effective therapeutic drugs to ensure the chemotherapy effect of liver cancer, and it is urgent to further develop new therapeutic drugs or methods combined with the research on the pathogenesis of liver cancer. [0003] The tumor stem cell hypot...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/115G01N33/569A61K31/711A61P35/00
CPCA61K31/711A61P35/00C12N15/115C12N2310/16G01N33/56966
Inventor 单鸿吕秀芳罗慧于海玲刘天泽李丹王皓帆
Owner THE FIFTH AFFILIATED HOSPITAL SUN YAT SEN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More