Supercharge Your Innovation With Domain-Expert AI Agents!

A gene for improving cadmium resistance and cadmium content and its application

A cadmium resistance and content technology, applied in the field of genetic engineering, can solve the problems of translocation, detoxification, unclear response-related proteins, and reduced cadmium resistance, so as to improve cadmium resistance and cadmium ion content, increase seedling root length, The effect of increasing the content of cadmium ions

Active Publication Date: 2021-04-02
RES INST OF SUBTROPICAL FORESTRY CHINESE ACAD OF FORESTRY
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In order to analyze the high resistance and super-accumulation ability of hyper-accumulative Sedum sedum, some researchers conducted research on the genes involved in ion transport, chelation, oxidative damage repair and other processes; however, whether there are specific Cadmium ion transport, detoxification, and response-related proteins are still unclear
Existing studies have shown that hyperaccumulative Sedum sedum SaNramp6 Genes can increase the accumulation of cadmium ions in plants, but excessive accumulation of cadmium ions reduces the cadmium resistance of transgenic plants

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A gene for improving cadmium resistance and cadmium content and its application
  • A gene for improving cadmium resistance and cadmium content and its application
  • A gene for improving cadmium resistance and cadmium content and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Construction of cDNA library of cadmium hyperaccumulating mine type Sedum southeastus

[0031] (1) Using the screened cadmium hyperaccumulating mine type Southeast Sedum (collected from an ancient lead-zinc mining area in Quzhou City, Zhejiang Province, and then transplanted to our laboratory) hydroponic seedlings as materials, treated with 400 μM·L -1 Cadmium chloride (CdCl 2 ) After the stress treatment, the total RNA of Sedum sedum leaves under cadmium stress was extracted with a plant tissue total RNA extraction kit (Total RNA Purification Kit), and purified mRNA was obtained by oligo(dT)-fiber column filtration;

[0032] (2) Obtaining full-length cDNA

[0033] cDNA strand synthesis using SMART TM cDNA library construction kit completed;

[0034] Synthesis of the first strand of cDNA: using the purified mRNA obtained in the above step (1) as a template, SMART™ IVOligonucleotide (10 μM) (sequence shown in SEQ.ID.No.3: 5'-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG-3'...

Embodiment 2

[0041] Screening and identification of cadmium-tolerant transformants

[0042] (1) Extract the mixed plasmids of the cadmium hyperaccumulation mine type Sedum sedum cDNA library obtained in Example 1, and electrically transform the cadmium-sensitive yeast mutant ( ycf1 ):

[0043] Use the plasmid DNA mini-extraction kit to extract the mixed plasmids of the cDNA library, and electro-transform the extracted mixed plasmids into ycf1 In the strain, the voltage used for electric transformation was 1.5V; the transformation product was plated to a concentration of 15 μM·L -1 CdCl 2 on the SG-U plate; invert at 28°C for 3 days, such as figure 1 It can be seen that the yeast colony is uniform in size and grows well.

[0044] (2) TA clone and sequence to obtain insert sequence information:

[0045] The yeast colonies obtained in step (1) in Example 2 were identified by PCR, separated by agarose gel electrophoresis and observed. SaCTP The gene target fragment band, the primers...

Embodiment 3

[0048] Yeast dot plate experimental verification SaCTP Genetic cadmium resistance

[0049] obtained by sequencing SaCTP The open reading frame (ORF) sequences of the genes were designed with primers NG3-F1 (as shown in SEQ.ID.No.10: atggcttccggcacgttctt) and NG3-R1 (as shown in SEQ.ID.No.11: tcaagcgacttgaattgtatc), from cDNA cloned from the library SaCTP gene coding sequence;

[0050] through Gateway technology SaCTP The gene was inserted into E. coli / yeast shuttle expression vector pYES2-DEST to obtain SaCTP Gene expression vector pYES2- SaCTP .

[0051] pYES2- SaCTP Yeast expression vector plasmid and pYES2-DEST empty vector plasmid were electroporated into cadmium-sensitive yeast mutants respectively ycf1 Among the strains, the obtained yeast transformants and empty vectors were streaked and cultured on SD-U plates for 3 days.

[0052] Pick a single colony, shake it and culture it to OD600 of 1.0 and dilute it 10-fold in sequence, and then dilute it in sequ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of gene engineering, in particular to a gene for improving the cadmium resistance and the cadmium content and application thereof. A cadmium hyper-accumulation mine type Alfred stonecrop c DNA library is constructed, the SaCTP gene is screened out, and the gene capable of improving the yeast cadmium resistance is verified by a yeast point plate test; and the SaCTP gene is subjected to heterologous expression in Arabidopsis thaliana, the cadmium resistance and the cadmium ion content of the transgenic Arabidopsis are improved. The obtained SaCTP geneprovides a gene resource for culturing new plant species with high cadmium resistance and cadmium content, and can be applied to plant biological remediation field of the soil polluted by heavy metals.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, and more particularly to a gene for improving cadmium resistance and cadmium content and use thereof. Background technique [0002] my country is a big agricultural country, and soil is the foundation of agriculture. As an important element of the natural environment, it passively carries most of the pollutants including heavy metals; the area of ​​arable land contaminated by heavy metals in my country has reached 20 million hectares, and only cadmium-contaminated food is produced every year. Up to 12 million tons, causing direct economic losses of more than 20 billion yuan. The refractory degradation, easy accumulation and transferability of heavy metal elements in the food chain pose a serious threat to the ecological environment and food safety, and are the "invisible killer" of human life, health and safety. In recent years, heavy metal contamination of food such as "cadmium rice" ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/29C07K14/415A01H5/00A01H6/20
CPCC07K14/415C12N15/8271
Inventor 刘明英贺雪莲卓仁英
Owner RES INST OF SUBTROPICAL FORESTRY CHINESE ACAD OF FORESTRY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com