Specific sequence of konjac soft rot bacteria, and detection primer and application thereof

A soft rot fungus, konjac technology is applied in the field of konjac soft rot fungus specific sequences and detection primers, which can solve the problems of high detection cost, difficult to distinguish subspecies, non-specific amplification, etc. False-positive, high-sensitivity effects

Active Publication Date: 2018-11-23
HUAZHONG AGRI UNIV
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, although conventional PCR and real-time quantitative PCR have been applied to the detection of konjac soft rot (Ma Gaizhuan et al., 2009; Wu et al., 2011), but PCR detection technology requires special equipment and high detection cost. It is not suitable for rapid application in the field, and most of the previously reported specific primers for the detection of Konjac soft rot are based on 16S rDNA and UPR specific primers (Ma Gaizhuan et al., 2009; Kang et al., 2003; Wu et al., 2011), but the applicant found that the primers designed for 16SrDNA have high homology bacteria for some closely related species or subspecies, it is difficult to distinguish, especially difficult to distinguish subspecies; and UPR-specific primers expand The added target sequence has high homology with its close relatives, for example, the homology with Pectobacterium carotovorum subsp.odoriferum is as high as 95%, and the homology with Pectobacterium carotovorum is 94%, which will cause Non-specific amplification, causing false positive problems

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific sequence of konjac soft rot bacteria, and detection primer and application thereof
  • Specific sequence of konjac soft rot bacteria, and detection primer and application thereof
  • Specific sequence of konjac soft rot bacteria, and detection primer and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Application of the specific sequence of Konjac soft rot pathogen (shown in SEQ ID NO.1) or primers designed for the sequence in the preparation of detection reagents for Konjac soft rot pathogen:

[0027] For the sequence shown in SEQ ID NO.1, LAMP primers were designed as follows:

[0028] F3: GCACAAGCTTGACTGCATAC

[0029] B3: TGGCGAGTTGTCCCCATAG

[0030] FIP: CGCCGTATCGGCACAGAAGAAAGCTTGGCGTTTCTCTCCA

[0031] BIP:GCCCCTCATCTCGCTGGCAATCATGTGCTTCCGGCAACAC

[0032] LF:AGAAACGGGATGGGGTGG

[0033] LB:GCCATCGAGCGTAGCGAA

[0034] The LAMP amplification system is as follows:

[0035]

[0036]

[0037] Bst 2.0 WarmStart DNA Polymerase was purchased from New England Biolabs.

[0038] The LAMP amplification procedure is as follows:

[0039] The reaction was carried out at 65°C for 40 minutes, and at 80°C for 5 minutes to stop the reaction.

[0040] Add 1000×SYBR Green I to the reaction product, the positive reaction shows green, indicating the existence of Konjac so...

Embodiment 2

[0042] Konjac soft rot LAMP primer specificity detection and sensitivity detection:

[0043] Konjac soft rot fungus LAMP primer specificity detection:

[0044] Using the method described in Example 1, the applicant has carried out LAMP detection to 50 bacterial strains (Table 1), including the gene sequences of species or subspecies (such as: Pectobacterium carotovorum subsp. and Pectobacterium atrosepticum), Dickeya spp. (e.g. Dickeyadadantii and Dickeya zeae), Erwinia spp. (e.g. E. amylovora and E. tracheiphila), and other pathogenic bacteria (e.g. Ralstonia solanacearum and Pantoea ananatis), and Common bacteria in soil (such as: Agrobac terium tumefaciens and Bacillus subtilis), the results are shown in Table 1, the results show that only Pcc can be detected specifically, other bacterial strains can not be detected, and can accurately distinguish Pcc and its close relative subtilis Species were distinguished, indicating that this set of primers can specifically detect Kon...

Embodiment 3

[0053] Field testing of Konjac soft rot fungus LAMP primers:

[0054] Using the method described in Example 1, 24 strains of Konjac soft rot fungi and other 31 negative control strains collected in the field were amplified using the LAMP primers of the present invention. The results showed that all 24 strains of Konjac soft rot fungi collected Detected, the LAMP amplification results of 31 negative control strains were all negative ( figure 1 ).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of plant protection and discloses a specific sequence of konjac soft rot bacteria, and a detection primer and application thereof. The nucleotide sequenceof the specific sequence is as shown in SEQ ID NO.1. Compared with identification targets before the application date, the specific detection target of the konjac soft rot bacteria, which is providedby the invention, has the characteristics of good specificity, strong stability and high sensitivity, and related species or subspecies of the konjac soft rot bacteria, which have high homology with the konjac soft rot bacteria can be well distinguished, so that false positive results are avoided. The konjac soft rot bacteria can be detected accurately, and thus a good tool is provided for field detection and early diagnosis of konjac soft rot disease.

Description

technical field [0001] The invention belongs to the technical field of plant protection, and in particular relates to the specific sequence of konjac soft rot pathogen and its detection primer and application. Background technique [0002] Konjac (Amorphophallus konjac) is a perennial herb whose bulbs are rich in glucomannan and widely used in food, chemical engineering, medicine, agriculture, and petroleum (Li et al., 2010). China is the main producer of konjac, with a planting area of ​​about 1.13×10 5 hectares (Wu Jinping, 2014). With the increase of konjac planting and continuous cropping area in my country, the occurrence of konjac bacterial soft rot has increased year by year, resulting in huge losses in konjac production (Wu et al., 2010, 2012). According to statistics, general konjac soft rot can lead to a 30%-50% yield reduction, and in some planting areas, the yield can be reduced by more than 80%, and sometimes even no harvest (Zhang Xin et al., 2010; Wu et al.,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/689C12Q1/6844C12Q1/04C12N15/11
CPCC12Q1/6844C12Q1/689C12Q2531/119
Inventor郑露孙苗苗黄俊斌刘浩
OwnerHUAZHONG AGRI UNIV