Unlock instant, AI-driven research and patent intelligence for your innovation.

Pardosa pseudoannulata A family insecticidal gene, mature peptide coded by the gene and application thereof

A technology of quasi-annular leopard spider and insecticidal gene, which is applied in the fields of application, insecticide, and genetic engineering, can solve problems such as not being able to meet the selection requirements of insect-resistant genes, expand insecticidal gene resources, reduce safety risks, The effect of reducing the use of pesticides

Active Publication Date: 2018-11-30
NANJING AGRICULTURAL UNIVERSITY
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In summary, the existing research on spider toxins cannot meet the selection requirements of insect resistance genes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pardosa pseudoannulata A family insecticidal gene, mature peptide coded by the gene and application thereof
  • Pardosa pseudoannulata A family insecticidal gene, mature peptide coded by the gene and application thereof
  • Pardosa pseudoannulata A family insecticidal gene, mature peptide coded by the gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Preparation of toxin

[0042] Design and Construction of Spider Toxin Gene

[0043] The pseudoannulata spider was collected from the paddy field of Pukou District, Nanjing City, Jiangsu Province, and was reared indoors with brown planthoppers for 90 days. The venom glands were obtained and the transcriptome was sequenced. According to the number, arrangement, domain prediction and sequence analysis of cystine, a class of candidate genes for pseudoannular toxins were obtained, and one of them was selected, namely PPTX-02, whose base sequence was shown as SEQ ID NO. 1, the amino acid sequence of its encoded protein is shown in SEQ ID NO.6, its signal peptide, propeptide and mature peptide are predicted by SpiderP (http: / / www.arachnoserver.org / spiderP.html), and its mature peptide The sequence was codon-optimized according to the codon preference of Escherichia coli, and the PPTX-02 toxin gene sequence designed for expression in Escherichia coli is shown in SEQ ID NO.16. ...

Embodiment 2

[0053] Using the design and construction method of the spider toxin gene in Example 1, the insecticidal genes SEQ ID NO.2-5 of the pseudoringed leopard spider were prepared: PPTX-03b, PPTX-05, PPTX-06, PPTX-18; and The corresponding recombinant plasmids were constructed by the same method, induced and expressed in large quantities respectively, and recombinant toxins encoded by different genes were obtained after purification.

[0054] The nucleotide sequence of the insecticidal gene PPTX-02 of the pseudoringed leopard spider is SEQ ID NO.1, as follows:

[0055] atgaagtttgtagttctctttggtattctgttagtaactcttttcagttactcttcagctgatatgcttgatgatttcgaagaagcggatgaagctgatgtgctgttgtctttaatagatgaggcacccagagccaaggaatgtaccccaaggtttaacgactgttctcgagatcgccacagctgctgccgaagcgaactgttcaaagatgtctgcacatgcttttacccagaaagtggagacagtgaagtctgcacatgccaacagcccaagcatctgaagtacatggaaaaagccaccgacaaggttaaacaattcggcaaaaagttcggcggcaagcttaaaaaattgttcggt

[0056] The nucleotide sequence of the insecticidal gene PPTX-0...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a pardosa pseudoannulata A family insecticidal gene as well as a mature peptide coded by the gene and application thereof. The nucleotide sequence of the pardosa pseudoannulataA family insecticidal gene is as shown in SEQ ID NO.1-5; the nucleotide sequence of the mature peptide coded by the pardosa pseudoannulata A family insecticidal gene is as shown in SEQ ID NO.11-15. Abioinformatics analysis method is used for screening genes in the transcription group database of the pardosa pseudoannulata, so as to obtain a kind of similar candidate gene of the pardosa pseudoannulata toxin, and the gene is constructed into a prokaryotic expression vector pET-32 a (+), the insecticidal peptide coded by the gene can be obtained, the insecticidal peptide is used as a brand-newinsecticidal gene resource, and has an insecticidal mechanism different from Bt toxins, so that the novel insecticidal gene resource with biological activity is expanded, various safety risks existingin the wide use of existing Bt toxins are reduced, and the gene has important scientific and practical significance for reducing the use of pesticides.

Description

technical field [0001] The invention belongs to the field of genetic engineering and biological control, and relates to a class of insecticidal gene and its coded protein, in particular to an insecticidal gene of the A family of Pseudomonas annulus and its coded mature peptide and its application. Background technique [0002] At present, the insecticidal gene widely used in pest control is mainly the gene of Bacillus thuringiensis that produces Bt toxin. Bt toxin shows extremely high insecticidal specificity to agricultural pests such as Lepidoptera, Diptera and Coleoptera. Therefore, the Bt toxin gene is transgenic into important crops such as cotton, corn, and tobacco, which are widely planted. Transgenic crops carrying insect-resistant genes play an important role in agricultural pest control. However, long-term use of a single insect resistance gene has resulted in increasing resistance of pests to Bt toxins. A variety of insect populations have developed resistance t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/435C12N15/12A01N37/46A01P7/04
CPCA01N37/46C07K14/43518
Inventor 刘泽文黄立鑫于娜张懿熙王照英
Owner NANJING AGRICULTURAL UNIVERSITY