Pardosa pseudoannulata A family insecticidal gene, mature peptide coded by the gene and application thereof
A technology of quasi-annular leopard spider and insecticidal gene, which is applied in the fields of application, insecticide, and genetic engineering, can solve problems such as not being able to meet the selection requirements of insect-resistant genes, expand insecticidal gene resources, reduce safety risks, The effect of reducing the use of pesticides
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Preparation of toxin
[0042] Design and Construction of Spider Toxin Gene
[0043] The pseudoannulata spider was collected from the paddy field of Pukou District, Nanjing City, Jiangsu Province, and was reared indoors with brown planthoppers for 90 days. The venom glands were obtained and the transcriptome was sequenced. According to the number, arrangement, domain prediction and sequence analysis of cystine, a class of candidate genes for pseudoannular toxins were obtained, and one of them was selected, namely PPTX-02, whose base sequence was shown as SEQ ID NO. 1, the amino acid sequence of its encoded protein is shown in SEQ ID NO.6, its signal peptide, propeptide and mature peptide are predicted by SpiderP (http: / / www.arachnoserver.org / spiderP.html), and its mature peptide The sequence was codon-optimized according to the codon preference of Escherichia coli, and the PPTX-02 toxin gene sequence designed for expression in Escherichia coli is shown in SEQ ID NO.16. ...
Embodiment 2
[0053] Using the design and construction method of the spider toxin gene in Example 1, the insecticidal genes SEQ ID NO.2-5 of the pseudoringed leopard spider were prepared: PPTX-03b, PPTX-05, PPTX-06, PPTX-18; and The corresponding recombinant plasmids were constructed by the same method, induced and expressed in large quantities respectively, and recombinant toxins encoded by different genes were obtained after purification.
[0054] The nucleotide sequence of the insecticidal gene PPTX-02 of the pseudoringed leopard spider is SEQ ID NO.1, as follows:
[0055] atgaagtttgtagttctctttggtattctgttagtaactcttttcagttactcttcagctgatatgcttgatgatttcgaagaagcggatgaagctgatgtgctgttgtctttaatagatgaggcacccagagccaaggaatgtaccccaaggtttaacgactgttctcgagatcgccacagctgctgccgaagcgaactgttcaaagatgtctgcacatgcttttacccagaaagtggagacagtgaagtctgcacatgccaacagcccaagcatctgaagtacatggaaaaagccaccgacaaggttaaacaattcggcaaaaagttcggcggcaagcttaaaaaattgttcggt
[0056] The nucleotide sequence of the insecticidal gene PPTX-0...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


