Pardosa pseudoannulata E family insecticidal genes, coded mature peptides and application of coded mature peptides
A technology of quasi-annular leopard spider and insecticidal gene, applied in the fields of application, insecticide, genetic engineering, etc., can solve problems such as not being able to meet the selection requirements of insect-resistant genes, expand insecticidal gene resources, and reduce insecticides use, and the effect of reducing security risks
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Preparation of toxin
[0042] Design and Construction of Spider Toxin Gene
[0043] The pseudoannulata spider was collected from the paddy field of Pukou District, Nanjing City, Jiangsu Province, and was reared indoors with brown planthoppers for 90 days. The venom glands were obtained and the transcriptome was sequenced. According to the number, arrangement, domain prediction and sequence analysis of cystine, a class of candidate genes of quasi-annular toxins were obtained, and one of them was selected, namely PPTX-08, whose base sequence was shown as SEQ ID NO. 1, the amino acid sequence of its coded protein is shown in SEQ ID NO.5, its signal peptide and mature peptide are predicted by SpiderP (http: / / www.arachnoserver.org / spiderP.html), and its mature peptide sequence is Bacteria codon preference for codon optimization, designed for expression in Escherichia coli PPTX-04 toxin gene sequence shown in SEQ ID NO.13, the designed gene was synthesized by Invitrogen, and...
Embodiment 2
[0053] Using the design and construction method of the spider toxin gene in Example 1, the insecticidal genes SEQ ID NO.2-4 of the pseudoringed leopard spider were prepared: PPTX-11, PPTX-36, PPTX-54; and through the same method The corresponding recombinant plasmids were constructed and expressed in large quantities respectively, and recombinant toxins encoded by different genes were obtained after purification.
[0054] The nucleotide sequence of the insecticidal gene PPTX-08 of the pseudoringed leopard spider is SEQ ID NO.1, as follows:
[0055] atgaattccaagatatttgctgtcctacttttattagccattacgacatgcgttctgtctgagcaatattgtccaaagtcaagtctttcaccttgcaaaaagataaatatcaggaacgattgctgtaaggatgaagactgcactggtggtagttggtgctgtgcgacgccctgcggtaacttctgtaaatatccagtagacaggcctggtggtcaaagggctgccggaggttcaagctgtaaaactggttatgtgtat
[0056] The nucleotide sequence of the insecticidal gene PPTX-11 of the pseudoringed leopard spider is SEQ ID NO.2, as follows:
[0057] atgagctccaagtactttactgttatattgcttgtagc...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



