Check patentability & draft patents in minutes with Patsnap Eureka AI!

Pardosa pseudoannulata E family insecticidal genes, coded mature peptides and application of coded mature peptides

A technology of quasi-annular leopard spider and insecticidal gene, applied in the fields of application, insecticide, genetic engineering, etc., can solve problems such as not being able to meet the selection requirements of insect-resistant genes, expand insecticidal gene resources, and reduce insecticides use, and the effect of reducing security risks

Active Publication Date: 2018-12-04
NANJING AGRICULTURAL UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In summary, the existing research on spider toxins cannot meet the selection requirements of insect resistance genes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pardosa pseudoannulata E family insecticidal genes, coded mature peptides and application of coded mature peptides
  • Pardosa pseudoannulata E family insecticidal genes, coded mature peptides and application of coded mature peptides
  • Pardosa pseudoannulata E family insecticidal genes, coded mature peptides and application of coded mature peptides

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Preparation of toxin

[0042] Design and Construction of Spider Toxin Gene

[0043] The pseudoannulata spider was collected from the paddy field of Pukou District, Nanjing City, Jiangsu Province, and was reared indoors with brown planthoppers for 90 days. The venom glands were obtained and the transcriptome was sequenced. According to the number, arrangement, domain prediction and sequence analysis of cystine, a class of candidate genes of quasi-annular toxins were obtained, and one of them was selected, namely PPTX-08, whose base sequence was shown as SEQ ID NO. 1, the amino acid sequence of its coded protein is shown in SEQ ID NO.5, its signal peptide and mature peptide are predicted by SpiderP (http: / / www.arachnoserver.org / spiderP.html), and its mature peptide sequence is Bacteria codon preference for codon optimization, designed for expression in Escherichia coli PPTX-04 toxin gene sequence shown in SEQ ID NO.13, the designed gene was synthesized by Invitrogen, and...

Embodiment 2

[0053] Using the design and construction method of the spider toxin gene in Example 1, the insecticidal genes SEQ ID NO.2-4 of the pseudoringed leopard spider were prepared: PPTX-11, PPTX-36, PPTX-54; and through the same method The corresponding recombinant plasmids were constructed and expressed in large quantities respectively, and recombinant toxins encoded by different genes were obtained after purification.

[0054] The nucleotide sequence of the insecticidal gene PPTX-08 of the pseudoringed leopard spider is SEQ ID NO.1, as follows:

[0055] atgaattccaagatatttgctgtcctacttttattagccattacgacatgcgttctgtctgagcaatattgtccaaagtcaagtctttcaccttgcaaaaagataaatatcaggaacgattgctgtaaggatgaagactgcactggtggtagttggtgctgtgcgacgccctgcggtaacttctgtaaatatccagtagacaggcctggtggtcaaagggctgccggaggttcaagctgtaaaactggttatgtgtat

[0056] The nucleotide sequence of the insecticidal gene PPTX-11 of the pseudoringed leopard spider is SEQ ID NO.2, as follows:

[0057] atgagctccaagtactttactgttatattgcttgtagc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses pardosa pseudoannulata E family insecticidal genes, coded mature peptides and an application of the coded mature peptides. The nucleotide sequences of the pardosa pseudoannulata E family insecticidal genes are shown in SEQ ID NO.1-4, and the amino acids of the mature peptides coded by the pardosa pseudoannulata E family insecticidal genes are shown in SEQ ID NO.9-12. The genes in a pardosa pseudoannulata transcriptome database are screened by a bioinformatics analysis method, similar candidate genes of pardosa pseudoannulata toxin are obtained, the genes are constructedinto a prokaryotic expression vector pET-32a (+), and thus the insecticidal peptides coded by the genes are obtained. As brand new insecticidal gene resources, the insecticidal peptides are differentfrom an insecticidal mechanism of Bt toxin, have important scientific and practical significance for expanding the novel insecticidal gene resources with biological activity, reducing various safetyrisks existing in the widespread use of the conventional Bt toxin and reducing the use of insecticides.

Description

technical field [0001] The invention belongs to the field of genetic engineering and biological control, and relates to a kind of insecticidal gene and its coded protein, in particular to an insecticidal gene of the E family of Pseudomonas annulus and its coded mature peptide and its application. Background technique [0002] At present, the insecticidal gene widely used in pest control is mainly the gene of Bacillus thuringiensis that produces Bt toxin. Bt toxin shows extremely high insecticidal specificity to agricultural pests such as Lepidoptera, Diptera and Coleoptera. Therefore, the Bt toxin gene is transgenic into important crops such as cotton, corn, and tobacco, which are widely planted. Transgenic crops carrying insect-resistant genes play an important role in agricultural pest control. However, long-term use of a single insect resistance gene has resulted in increasing resistance of pests to Bt toxins. A variety of insect populations have developed resistance to...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/12C07K14/435C12N15/70A01N37/46A01P7/04
CPCA01N37/46C12N15/70C07K14/43518
Inventor 刘泽文黄立鑫王照英张懿熙鲍海波
Owner NANJING AGRICULTURAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More