Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Insecticidal genes of the d family of Pseudomonas annulus and their encoded mature peptides and their applications

A technology of quasi-annular leopard spider and insecticidal gene, applied in the fields of application, insecticide, genetic engineering, etc., can solve problems such as not being able to meet the selection requirements of insect-resistant genes, maximize protein production, optimize purification conditions, optimize The effect of inducing conditions

Active Publication Date: 2022-02-22
NANJING AGRICULTURAL UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In summary, the existing research on spider toxins cannot meet the selection requirements of insect resistance genes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Insecticidal genes of the d family of Pseudomonas annulus and their encoded mature peptides and their applications
  • Insecticidal genes of the d family of Pseudomonas annulus and their encoded mature peptides and their applications
  • Insecticidal genes of the d family of Pseudomonas annulus and their encoded mature peptides and their applications

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Preparation of toxins

[0042] Design and construction of spider toxin gene

[0043] The planted loop spider from the water rice field in Pukou District, Nanjing, Jiangsu Province, and raised 90 days in indoor use of brown planthopper, taking poison gland and performing transcription group sequencing. According to the results of the annotation, screened the spider toxin gene, according to the half The number, arrangement, domain prediction and sequence analysis of cystine, obtaining a class of candidate genes of a class of jerkoplastrid, and one of them, i.e., PPTX-07, the base sequence such as SEQ ID NO. 1 showing the amino acid sequence encoding the protein, such as SEQ IDNO.6, predicts its signal peptide, forward peptide, and ripe peptide by spiderp (http: / / www.rachnoserver.org / spiderp.html), and mature the peptide The sequence is optimized in accordance with E. coli Codon preferences, and the PPTX-07 toxin gene sequence used to expressed in E. coli is designed such as S...

Embodiment 2

[0053] Using the design and construction method of the spider toxin gene in Example 1, the insecticidal gene SEQ ID NO. 2-4: PPTX-13, PPTX-28, PPTX-38, PPTX-28, PPTX-38, PPTX-39; The corresponding recombinant plasmid was constructed by the same method and expressed a large amount of expression, and the recombinant toxins encoded by different genes were purified.

[0054] The nucleotide sequence of the insecticide gene PPTX-07 of the joining leopard spider is SEQ ID NO.1, as follows:

[0055] atgatgtctttgaaaatgcaagcgatgttgttggttgtaggcttgattacattcatagcagttcacgctgaagaagatataagtgaaaccgtagaatcagaacgatcgtgcgctaaggaataccaaagatgtgattggaacaacaaaccctgttgcgataatatttcttgcgtgtgtagcttgataggaaccaactgtgaatgtaagaaaggtatcatacgtactataaaagactggttcagtggaaaa

[0056] The nucleotide sequence of the insecticide PPTX-13 of the joining leopard spider is SEQ ID NO.2, as follows:

[0057] atgatgagagcctcaactgtattcggattatgtgcaattgctgttttgctgcttacgatcccagacgtttctggtgaagatgagatcaattctcaaaatgctccagaagaacgtggatact...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses an insecticidal gene of the D-family of pseudoannulus and its encoded mature peptide and its application. The nucleotide sequence of the insecticidal gene of the D-family of the pseudo-annula is shown in SEQ ID NO.1‑5 shown; the amino acid of the mature peptide encoded by the insecticidal gene of the D-family of Pseudomonas annulus is shown in SEQ ID NO.11‑15. The present invention uses a bioinformatics analysis method to screen the genes in the quasi-annulata transcriptome database to obtain a class of similar candidate genes for quasi-annulatoxin, and construct the gene into a prokaryotic expression vector pET‑32a (+), the insecticidal peptide encoded by the gene can be obtained. As a new insecticidal gene resource, the insecticidal peptide has an insecticidal mechanism different from Bt toxin, and is useful for expanding new insecticidal gene resources with biological activity. It is of great scientific and practical significance to reduce various safety risks in the widespread use of existing Bt toxins and to reduce the use of pesticides.

Description

Technical field [0001] The present invention belongs to the field of genetic engineering and biological prevention, involving a type of insecticidal gene and its encoded protein, specifically involved in a ripple leopardia D family insecticide gene and its encoding ripe peptide and application thereof. Background technique [0002] The insecticidal genes currently used in pest control is mainly generated by BT toxin, BT toxins, and Agricultural pests such as BT toxins, bicycratives, and Cochetlets. Specificity. Therefore, the BT toxin gene is transgenic to cotton, corn, tobacco and other extensive cultivation. Transgenic crops carrying insect resistant genes play an important role in agricultural pest control. However, the long-term use of a single anti-insect gene increases the resistance of pest to BT toxins. A variety of insect groups produce resistance to BT protein preparations and BT transgenic crops in natural environments, such as cotton bollworm, small martillalla, di-bu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/12C07K14/435A01N47/44A01P7/04
CPCA01N47/44C07K14/43518
Inventor 刘泽文黄立鑫张懿熙鲍海波王照英
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com