Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Insecticidal genes of the Pseudoannulata spider b family and their encoded mature peptides and their applications

A technology of quasi-ringed leopard spider and insecticidal gene, which is applied in the fields of application, insecticide, genetic engineering, etc., can solve problems such as not being able to meet the selection requirements of insect-resistant genes, achieve maximum protein production, optimize induction conditions, and efficiently yield effect

Active Publication Date: 2022-03-29
NANJING AGRICULTURAL UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In summary, the existing research on spider toxins cannot meet the selection requirements of insect resistance genes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Insecticidal genes of the Pseudoannulata spider b family and their encoded mature peptides and their applications
  • Insecticidal genes of the Pseudoannulata spider b family and their encoded mature peptides and their applications
  • Insecticidal genes of the Pseudoannulata spider b family and their encoded mature peptides and their applications

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Preparation of toxins

[0042] Design and construction of spider toxin genes

[0043] Pseudo-ringed leopard spiders were collected from paddy fields in Pukou District, Nanjing City, Jiangsu Province, and reared with brown planthopper indoors for 90 days. The venom glands were taken and the transcriptome sequenced. The number, arrangement, structural domain prediction and sequence analysis of cystines were used to obtain a class of candidate genes of pseudo-ringed leopard spider toxin, and one of them, PPTX-04, was selected, and its base sequence was as shown in SEQ ID NO. 1, the amino acid sequence of the encoded protein is shown in SEQID NO.4, and its signal peptide, propeptide and mature peptide were predicted by SpiderP (http: / / www.arachnoserver.org / spiderP.html), and it was matured The peptide sequence was codon-optimized according to the codon preference of E. coli, and the PPTX-04 toxin gene sequence for expression in E. coli was designed as shown in SEQ ID NO. 1...

Embodiment 2

[0053] Using the design and construction method of the spider toxin gene in Example 1, the insecticidal genes of the pseudo-ringed leopard spider SEQ ID NO. 2-3: PPTX-20, PPTX-21 were prepared; and the corresponding The recombinant plasmids were induced to express in a large amount, and the recombinant toxins encoded by different genes were obtained after purification.

[0054] The nucleotide sequence of the insecticidal gene PPTX-04 of the pseudo-ringed leopard spider is SEQ ID NO.1, as follows:

[0055] atgaaattcgcagttgttctacttttttccctggttgtacttgcagttgcaagtgaatttgtggaggaagatataagagatattgaagaagaacttccagagcaacagaggggttgcgctgatcttcgggaaccatgtacagacgactgcagctgctgtggaagtgaaggagtttgcaactgtaaccatccgtccgtaaacctggttgcttctgcaaaaggcagagatagatagat

[0056] The nucleotide sequence of the insecticidal gene PPTX-20 of the pseudo-ringed leopard spider is SEQ ID NO.2, as follows:

[0057] atgaaatacacaatagttctgctgttttcgttggtcttgcttgttgttgcaagcgaatcggttgaagatactaatagagaggattttccagaacaacaaagag...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses an insecticidal gene of the Pseudoannulata family B and its encoded mature peptide and its application. The nucleotide sequence of the Pseudoannula B family insecticidal gene is shown in SEQ ID NO.1‑3 shown; the amino acid of the mature peptide encoded by the insecticidal gene of the pseudoringed leopard spider B family is shown in SEQ ID NO.7-9. The present invention uses a bioinformatics analysis method to screen the genes in the quasi-annulata transcriptome database to obtain a class of similar candidate genes for quasi-annulatoxin, and construct the gene into a prokaryotic expression vector pET‑32a (+), the insecticidal peptide encoded by the gene can be obtained. As a new insecticidal gene resource, the insecticidal peptide has an insecticidal mechanism different from Bt toxin, and is useful for expanding new insecticidal gene resources with biological activity. It is of great scientific and practical significance to reduce various safety risks in the widespread use of existing Bt toxins and to reduce the use of pesticides.

Description

technical field [0001] The invention belongs to the fields of genetic engineering and biological control, and relates to a class of insecticidal genes and encoded proteins thereof, in particular to a pseudo-ringed leopard spider B family insecticidal gene and its encoded mature peptides and applications. Background technique [0002] At present, the insecticidal genes widely used in pest control are mainly Bt toxin genes produced by Bacillus thuringiensis. Bt toxins show extremely high insecticidal specificity to agricultural pests such as Lepidoptera, Diptera and Coleoptera. Therefore, the Bt toxin gene was transgenic into cotton, corn, tobacco and other important crops that are widely grown. Transgenic crops carrying insect-resistant genes play an important role in agricultural pest control. However, the long-term use of a single insect resistance gene has resulted in increasing pest resistance to Bt toxins. A variety of insect groups have developed resistance to Bt prot...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/12C07K14/435A01N47/44A01P7/04
CPCA01N47/44C07K14/43518
Inventor 刘泽文黄立鑫于娜王照英张懿熙
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com