Insecticidal genes of the e family of Leopard pseudoringenia and their encoded mature peptides and their application

A pseudo-ringed leopard spider, insecticidal gene technology, applied in the application, insecticide, genetic engineering and other directions, can solve the problem of not meeting the needs of insect resistance gene selection, and achieve maximum protein yield, high activity, and optimized induction. The effect of the condition

Active Publication Date: 2022-03-29
NANJING AGRICULTURAL UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In summary, the existing research on spider toxins cannot meet the selection requirements of insect resistance genes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Insecticidal genes of the e family of Leopard pseudoringenia and their encoded mature peptides and their application
  • Insecticidal genes of the e family of Leopard pseudoringenia and their encoded mature peptides and their application
  • Insecticidal genes of the e family of Leopard pseudoringenia and their encoded mature peptides and their application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Preparation of toxin

[0042] Design and Construction of Spider Toxin Gene

[0043] The pseudoringed spider was collected from the paddy field in Pukou District, Nanjing City, Jiangsu Province, and was reared indoors with brown planthoppers for 90 days. The venom glands were obtained and the transcriptome was sequenced. According to the number, arrangement, domain prediction and sequence analysis of cystine, a class of candidate genes of quasi-annular toxins were obtained, and one of them was selected, namely PPTX-08, whose base sequence was shown as SEQ ID NO. 1, the amino acid sequence of its encoded protein is shown in SEQ ID NO.5, its signal peptide and mature peptide are predicted by SpiderP (http: / / www.arachnoserver.org / spiderP.html), and its mature peptide sequence is Bacteria codon preference was optimized for codons, and the PPTX-04 toxin gene sequence for expression in Escherichia coli was designed as shown in SEQ ID NO.13. The designed gene was synthesized b...

Embodiment 2

[0053] Using the design and construction method of the spider toxin gene in Example 1, the insecticidal genes SEQ ID NO.2-4 of the pseudoringed leopard spider were prepared: PPTX-11, PPTX-36, PPTX-54; and through the same method The corresponding recombinant plasmids were constructed and expressed in large quantities respectively, and recombinant toxins encoded by different genes were obtained after purification.

[0054] The nucleotide sequence of the insecticidal gene PPTX-08 of the pseudoringed leopard spider is SEQ ID NO.1, as follows:

[0055] atgaattccaagatatttgctgtcctacttttattagccattacgacatgcgttctgtctgagcaatattgtccaaagtcaagtctttcaccttgcaaaaagataaatatcaggaacgattgctgtaaggatgaagactgcactggtggtagttggtgctgtgcgacgccctgcggtaacttctgtaaatatccagtagacaggcctggtggtcaaagggctgccggaggttcaagctgtaaaactggttatgtgtat

[0056] The nucleotide sequence of the insecticidal gene PPTX-11 of the pseudoringed leopard spider is SEQ ID NO.2, as follows:

[0057] atgagctccaagtactttactgttatattgcttgtagc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses an insecticidal gene of the Pseudomonas annulus E family and its encoded mature peptide and its application. The nucleotide sequence of the E family insecticidal gene of the Pseudoannus arachnid is shown in SEQ ID NO.1‑4 shown; the amino acid of the mature peptide encoded by the insecticidal gene of the E family of Pseudomonas annulus is shown in SEQ ID NO.9-12. The present invention uses a bioinformatics analysis method to screen the genes in the quasi-annulata transcriptome database to obtain a class of similar candidate genes for quasi-annulatoxin, and construct the gene into a prokaryotic expression vector pET‑32a (+), the insecticidal peptide encoded by the gene can be obtained. As a new insecticidal gene resource, the insecticidal peptide has an insecticidal mechanism different from Bt toxin, and is useful for expanding new insecticidal gene resources with biological activity. It is of great scientific and practical significance to reduce various safety risks in the widespread use of existing Bt toxins and to reduce the use of pesticides.

Description

technical field [0001] The invention belongs to the field of genetic engineering and biological control, and relates to a kind of insecticidal gene and its coded protein, in particular to an insecticidal gene of the E family of Pseudomonas annulus and its coded mature peptide and its application. Background technique [0002] At present, the insecticidal gene widely used in pest control is mainly the gene of Bacillus thuringiensis that produces Bt toxin. Bt toxin shows extremely high insecticidal specificity to agricultural pests such as Lepidoptera, Diptera and Coleoptera. Therefore, the Bt toxin gene is transgenic into important crops such as cotton, corn, and tobacco, which are widely planted. Transgenic crops carrying insect-resistant genes play an important role in agricultural pest control. However, long-term use of a single insect resistance gene has resulted in increasing resistance of pests to Bt toxins. A variety of insect populations have developed resistance to...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/12C07K14/435C12N15/70A01N37/46A01P7/04
CPCA01N37/46C12N15/70C07K14/43518
Inventor刘泽文黄立鑫王照英张懿熙鲍海波
OwnerNANJING AGRICULTURAL UNIVERSITY